Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636332_at:

>probe:Drosophila_2:1636332_at:549:99; Interrogation_Position=1873; Antisense; AGAGACAATCAATCGCTGTTATTTA
>probe:Drosophila_2:1636332_at:86:693; Interrogation_Position=1927; Antisense; TTTGTATTTTGTCCCCAGCTTAACT
>probe:Drosophila_2:1636332_at:84:727; Interrogation_Position=1935; Antisense; TTGTCCCCAGCTTAACTGTATTAAT
>probe:Drosophila_2:1636332_at:240:177; Interrogation_Position=2015; Antisense; AAACGTTGTGTAATATTTGCCTACT
>probe:Drosophila_2:1636332_at:341:721; Interrogation_Position=2031; Antisense; TTGCCTACTTTTAAGTTGCCGCCAC
>probe:Drosophila_2:1636332_at:89:255; Interrogation_Position=2067; Antisense; CAAACTATAGCCACTCTTTCGATAT
>probe:Drosophila_2:1636332_at:478:181; Interrogation_Position=2112; Antisense; AAAAGACAATTTTAGCTAGCGCACA
>probe:Drosophila_2:1636332_at:673:675; Interrogation_Position=2124; Antisense; TAGCTAGCGCACATCATTCCAATTG
>probe:Drosophila_2:1636332_at:726:7; Interrogation_Position=2139; Antisense; ATTCCAATTGCGAATCGTCCACCGG
>probe:Drosophila_2:1636332_at:38:637; Interrogation_Position=2153; Antisense; TCGTCCACCGGTTCAGATAACTTTT
>probe:Drosophila_2:1636332_at:111:185; Interrogation_Position=2217; Antisense; AAAATCCAATTTCCACACAACACTA
>probe:Drosophila_2:1636332_at:5:641; Interrogation_Position=2254; Antisense; TCTGATTCTGAATGCCGTGACACCC
>probe:Drosophila_2:1636332_at:220:627; Interrogation_Position=2266; Antisense; TGCCGTGACACCCAAATGAAGATAA
>probe:Drosophila_2:1636332_at:39:163; Interrogation_Position=2402; Antisense; ACAATACATACCATGCTGCTGCAAT

Paste this into a BLAST search page for me
AGAGACAATCAATCGCTGTTATTTATTTGTATTTTGTCCCCAGCTTAACTTTGTCCCCAGCTTAACTGTATTAATAAACGTTGTGTAATATTTGCCTACTTTGCCTACTTTTAAGTTGCCGCCACCAAACTATAGCCACTCTTTCGATATAAAAGACAATTTTAGCTAGCGCACATAGCTAGCGCACATCATTCCAATTGATTCCAATTGCGAATCGTCCACCGGTCGTCCACCGGTTCAGATAACTTTTAAAATCCAATTTCCACACAACACTATCTGATTCTGAATGCCGTGACACCCTGCCGTGACACCCAAATGAAGATAAACAATACATACCATGCTGCTGCAAT

Full Affymetrix probeset data:

Annotations for 1636332_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime