FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636334_at:

>probe:Drosophila_2:1636334_at:26:113; Interrogation_Position=1040; Antisense; AGCAACAGCCATACGATGCCTATGA
>probe:Drosophila_2:1636334_at:666:65; Interrogation_Position=1097; Antisense; ATGGAGACTGCTACGATCGCTACTT
>probe:Drosophila_2:1636334_at:371:51; Interrogation_Position=1138; Antisense; ATGCGCGAGTCGGTGAATATCATCA
>probe:Drosophila_2:1636334_at:641:547; Interrogation_Position=1203; Antisense; GGATGATCTGAAGATCTGCCCTCCG
>probe:Drosophila_2:1636334_at:451:37; Interrogation_Position=1268; Antisense; ATCATTTCAAGCACTTCTCGCAAGG
>probe:Drosophila_2:1636334_at:352:533; Interrogation_Position=1299; Antisense; GGTGCCTCCGGGACAGACGTACTGT
>probe:Drosophila_2:1636334_at:293:489; Interrogation_Position=1317; Antisense; GTACTGTGCCGTTGAATCGCCCAAG
>probe:Drosophila_2:1636334_at:226:535; Interrogation_Position=1342; Antisense; GGTGAATTCGGAGCATTCCTCATCT
>probe:Drosophila_2:1636334_at:53:617; Interrogation_Position=1393; Antisense; TGCAAGATTCGTCCAGCTTCCTATG
>probe:Drosophila_2:1636334_at:157:647; Interrogation_Position=1419; Antisense; TCATCTAGCCCTCATGGCCAAAATG
>probe:Drosophila_2:1636334_at:489:595; Interrogation_Position=1470; Antisense; TGTGGCCATTATTGGATCGCTGGAC
>probe:Drosophila_2:1636334_at:376:45; Interrogation_Position=1485; Antisense; ATCGCTGGACATCGTTTTTGGTGAA
>probe:Drosophila_2:1636334_at:621:3; Interrogation_Position=952; Antisense; ATTGGAGTCATATCCGCACACGATG
>probe:Drosophila_2:1636334_at:562:191; Interrogation_Position=982; Antisense; AACTATGGATGCACTGGACCCGTTC

Paste this into a BLAST search page for me
AGCAACAGCCATACGATGCCTATGAATGGAGACTGCTACGATCGCTACTTATGCGCGAGTCGGTGAATATCATCAGGATGATCTGAAGATCTGCCCTCCGATCATTTCAAGCACTTCTCGCAAGGGGTGCCTCCGGGACAGACGTACTGTGTACTGTGCCGTTGAATCGCCCAAGGGTGAATTCGGAGCATTCCTCATCTTGCAAGATTCGTCCAGCTTCCTATGTCATCTAGCCCTCATGGCCAAAATGTGTGGCCATTATTGGATCGCTGGACATCGCTGGACATCGTTTTTGGTGAAATTGGAGTCATATCCGCACACGATGAACTATGGATGCACTGGACCCGTTC

Full Affymetrix probeset data:

Annotations for 1636334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720