FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636335_at:

>probe:Drosophila_2:1636335_at:503:659; Interrogation_Position=1084; Antisense; TAACCTCTGCTTACTTACATTTGCG
>probe:Drosophila_2:1636335_at:454:667; Interrogation_Position=1099; Antisense; TACATTTGCGTTGTCCTGGAGTGCC
>probe:Drosophila_2:1636335_at:58:633; Interrogation_Position=1157; Antisense; TCCGCGATGCGTTTGTCCAGTAACT
>probe:Drosophila_2:1636335_at:194:521; Interrogation_Position=1237; Antisense; GTGGCACAATACTCACGTTCGTTTG
>probe:Drosophila_2:1636335_at:39:229; Interrogation_Position=683; Antisense; AATGTGAGCCCTATAACAGCTTCCC
>probe:Drosophila_2:1636335_at:611:187; Interrogation_Position=716; Antisense; AACACTCGCACCTGGATAGTCACAT
>probe:Drosophila_2:1636335_at:328:149; Interrogation_Position=737; Antisense; ACATCCCGTTGGTGGTGCTAATTTC
>probe:Drosophila_2:1636335_at:225:655; Interrogation_Position=755; Antisense; TAATTTCCCAGACATTGCCCAATAC
>probe:Drosophila_2:1636335_at:713:669; Interrogation_Position=777; Antisense; TACGGCTCTGCGGAATAGGCGTTCA
>probe:Drosophila_2:1636335_at:165:71; Interrogation_Position=793; Antisense; AGGCGTTCACCAGATAGCCACAGAA
>probe:Drosophila_2:1636335_at:281:389; Interrogation_Position=815; Antisense; GAAACAGTGAGTTCGTCCTCTGGCT
>probe:Drosophila_2:1636335_at:79:199; Interrogation_Position=868; Antisense; AACGTTACGCTCAGTCTCTATGGAA
>probe:Drosophila_2:1636335_at:572:307; Interrogation_Position=911; Antisense; CCAGCTGTGTTTTAGGTGTTCGAAA
>probe:Drosophila_2:1636335_at:29:131; Interrogation_Position=947; Antisense; ACCGGGACGCGGACTATTACATGGC

Paste this into a BLAST search page for me
TAACCTCTGCTTACTTACATTTGCGTACATTTGCGTTGTCCTGGAGTGCCTCCGCGATGCGTTTGTCCAGTAACTGTGGCACAATACTCACGTTCGTTTGAATGTGAGCCCTATAACAGCTTCCCAACACTCGCACCTGGATAGTCACATACATCCCGTTGGTGGTGCTAATTTCTAATTTCCCAGACATTGCCCAATACTACGGCTCTGCGGAATAGGCGTTCAAGGCGTTCACCAGATAGCCACAGAAGAAACAGTGAGTTCGTCCTCTGGCTAACGTTACGCTCAGTCTCTATGGAACCAGCTGTGTTTTAGGTGTTCGAAAACCGGGACGCGGACTATTACATGGC

Full Affymetrix probeset data:

Annotations for 1636335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720