FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636336_at:

>probe:Drosophila_2:1636336_at:642:709; Interrogation_Position=1005; Antisense; TTAACCGCCGTCGAGTCTGAAATCG
>probe:Drosophila_2:1636336_at:410:367; Interrogation_Position=1029; Antisense; GAATCCCATTCTTTAGACAGTTGAC
>probe:Drosophila_2:1636336_at:292:95; Interrogation_Position=1047; Antisense; AGTTGACGGCAGTCGACATCGGATC
>probe:Drosophila_2:1636336_at:137:267; Interrogation_Position=1063; Antisense; CATCGGATCTCGAGGTCTTTTTGAT
>probe:Drosophila_2:1636336_at:633:525; Interrogation_Position=594; Antisense; GGGCACACCGATATTTTCGAGCATA
>probe:Drosophila_2:1636336_at:591:419; Interrogation_Position=612; Antisense; GAGCATAGCCAACTGGTCTACCTCA
>probe:Drosophila_2:1636336_at:512:41; Interrogation_Position=649; Antisense; ATCGGGTGTTGGACAAGCTGCAGCC
>probe:Drosophila_2:1636336_at:557:583; Interrogation_Position=703; Antisense; TGGACCACAATCACTTCAAGGGCCT
>probe:Drosophila_2:1636336_at:33:213; Interrogation_Position=798; Antisense; AAGACGAGGGCCGTGCTGAGCACCT
>probe:Drosophila_2:1636336_at:566:673; Interrogation_Position=822; Antisense; TACCATGTGTTTGAGCTGCTGACCA
>probe:Drosophila_2:1636336_at:547:125; Interrogation_Position=843; Antisense; ACCAAAGTTGCTGCCGGTCAGGACT
>probe:Drosophila_2:1636336_at:245:73; Interrogation_Position=862; Antisense; AGGACTGGACTACGGCCATTCTGGA
>probe:Drosophila_2:1636336_at:494:415; Interrogation_Position=936; Antisense; GAGCCGAATCATTGCTTGGAGCAGC
>probe:Drosophila_2:1636336_at:280:333; Interrogation_Position=984; Antisense; GCTGAGTCAGATAAGCCCACCTTAA

Paste this into a BLAST search page for me
TTAACCGCCGTCGAGTCTGAAATCGGAATCCCATTCTTTAGACAGTTGACAGTTGACGGCAGTCGACATCGGATCCATCGGATCTCGAGGTCTTTTTGATGGGCACACCGATATTTTCGAGCATAGAGCATAGCCAACTGGTCTACCTCAATCGGGTGTTGGACAAGCTGCAGCCTGGACCACAATCACTTCAAGGGCCTAAGACGAGGGCCGTGCTGAGCACCTTACCATGTGTTTGAGCTGCTGACCAACCAAAGTTGCTGCCGGTCAGGACTAGGACTGGACTACGGCCATTCTGGAGAGCCGAATCATTGCTTGGAGCAGCGCTGAGTCAGATAAGCCCACCTTAA

Full Affymetrix probeset data:

Annotations for 1636336_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720