FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636338_at:

>probe:Drosophila_2:1636338_at:461:91; Interrogation_Position=1004; Antisense; AGTATTTGCCACCTCCTGGAGAGAA
>probe:Drosophila_2:1636338_at:451:425; Interrogation_Position=1022; Antisense; GAGAGAATGAGGTCACCCCGACACA
>probe:Drosophila_2:1636338_at:402:127; Interrogation_Position=1052; Antisense; AGCCAACTGCACCAGTGCCGGAATA
>probe:Drosophila_2:1636338_at:48:87; Interrogation_Position=1065; Antisense; AGTGCCGGAATACGGACCACCACCG
>probe:Drosophila_2:1636338_at:313:617; Interrogation_Position=1146; Antisense; TGCACCAGGACCTACTTATCAACCA
>probe:Drosophila_2:1636338_at:638:129; Interrogation_Position=1326; Antisense; ACCTGCACCAACTCCGGAGTACGGA
>probe:Drosophila_2:1636338_at:237:607; Interrogation_Position=1377; Antisense; TGAGGCAGGCTCTCTGGGACCCGAT
>probe:Drosophila_2:1636338_at:382:279; Interrogation_Position=1388; Antisense; CTCTGGGACCCGATGGCTACAACTA
>probe:Drosophila_2:1636338_at:672:665; Interrogation_Position=1405; Antisense; TACAACTACAACAAGCCTGCCAAAC
>probe:Drosophila_2:1636338_at:84:217; Interrogation_Position=1456; Antisense; AAGTACTCAAAACCACTGTCCTGTG
>probe:Drosophila_2:1636338_at:275:143; Interrogation_Position=1470; Antisense; ACTGTCCTGTGAACCACCATTGGAG
>probe:Drosophila_2:1636338_at:75:615; Interrogation_Position=1479; Antisense; TGAACCACCATTGGAGCCAGTTGCC
>probe:Drosophila_2:1636338_at:253:303; Interrogation_Position=1504; Antisense; CCGCCACTCAAATCTTTTTCCAAAT
>probe:Drosophila_2:1636338_at:303:127; Interrogation_Position=992; Antisense; AGCCAGGATCTGAGTATTTGCCACC

Paste this into a BLAST search page for me
AGTATTTGCCACCTCCTGGAGAGAAGAGAGAATGAGGTCACCCCGACACAAGCCAACTGCACCAGTGCCGGAATAAGTGCCGGAATACGGACCACCACCGTGCACCAGGACCTACTTATCAACCAACCTGCACCAACTCCGGAGTACGGATGAGGCAGGCTCTCTGGGACCCGATCTCTGGGACCCGATGGCTACAACTATACAACTACAACAAGCCTGCCAAACAAGTACTCAAAACCACTGTCCTGTGACTGTCCTGTGAACCACCATTGGAGTGAACCACCATTGGAGCCAGTTGCCCCGCCACTCAAATCTTTTTCCAAATAGCCAGGATCTGAGTATTTGCCACC

Full Affymetrix probeset data:

Annotations for 1636338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720