Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636339_at:

>probe:Drosophila_2:1636339_at:694:583; Interrogation_Position=1015; Antisense; TGGCATTAGCCACGTGTTCGAGCTG
>probe:Drosophila_2:1636339_at:482:625; Interrogation_Position=1038; Antisense; TGCCCCTCACGGATGTGGAGCAAAG
>probe:Drosophila_2:1636339_at:586:311; Interrogation_Position=1079; Antisense; GCCAACATTCTTCTGGAGGCCCAAT
>probe:Drosophila_2:1636339_at:228:439; Interrogation_Position=1094; Antisense; GAGGCCCAATGCTCTCTGAGTATTT
>probe:Drosophila_2:1636339_at:599:429; Interrogation_Position=1111; Antisense; GAGTATTTGATTCGCGGTTTGGCCA
>probe:Drosophila_2:1636339_at:516:539; Interrogation_Position=1126; Antisense; GGTTTGGCCAAAGTCACTGGATTTT
>probe:Drosophila_2:1636339_at:548:307; Interrogation_Position=1164; Antisense; CCATGAATTCTTTAGTAGCTGAGCT
>probe:Drosophila_2:1636339_at:420:211; Interrogation_Position=1326; Antisense; AAGAACTTATGCCTCCATTCAATGC
>probe:Drosophila_2:1636339_at:577:387; Interrogation_Position=1404; Antisense; GAAAACCCGGAGAAGACCAGCTGTG
>probe:Drosophila_2:1636339_at:454:433; Interrogation_Position=1430; Antisense; GAGTGAGTAGGCAAGCCCTTTGCCC
>probe:Drosophila_2:1636339_at:688:275; Interrogation_Position=1454; Antisense; CTTTCCCACTTTCAGCTAGAGCAAG
>probe:Drosophila_2:1636339_at:562:421; Interrogation_Position=1472; Antisense; GAGCAAGTGAGATGCACACACACAC
>probe:Drosophila_2:1636339_at:505:691; Interrogation_Position=1547; Antisense; TTTGCTAGCATTTCTGTGACCCTGT
>probe:Drosophila_2:1636339_at:679:397; Interrogation_Position=974; Antisense; GACAACGTGGTGCTATCGCTGCCCT

Paste this into a BLAST search page for me
TGGCATTAGCCACGTGTTCGAGCTGTGCCCCTCACGGATGTGGAGCAAAGGCCAACATTCTTCTGGAGGCCCAATGAGGCCCAATGCTCTCTGAGTATTTGAGTATTTGATTCGCGGTTTGGCCAGGTTTGGCCAAAGTCACTGGATTTTCCATGAATTCTTTAGTAGCTGAGCTAAGAACTTATGCCTCCATTCAATGCGAAAACCCGGAGAAGACCAGCTGTGGAGTGAGTAGGCAAGCCCTTTGCCCCTTTCCCACTTTCAGCTAGAGCAAGGAGCAAGTGAGATGCACACACACACTTTGCTAGCATTTCTGTGACCCTGTGACAACGTGGTGCTATCGCTGCCCT

Full Affymetrix probeset data:

Annotations for 1636339_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime