FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636340_at:

>probe:Drosophila_2:1636340_at:19:595; Interrogation_Position=1054; Antisense; TGTGGACCTCGGCTTATCATTAATC
>probe:Drosophila_2:1636340_at:512:35; Interrogation_Position=1069; Antisense; ATCATTAATCCGAAGTCCTCCGAGT
>probe:Drosophila_2:1636340_at:294:105; Interrogation_Position=1127; Antisense; AGAAACTACCACAGTACTCGTGCCA
>probe:Drosophila_2:1636340_at:185:265; Interrogation_Position=1170; Antisense; CAGAAACTACTATCCCGGCATCAAC
>probe:Drosophila_2:1636340_at:589:569; Interrogation_Position=1186; Antisense; GGCATCAACATCTACACACAGTTCG
>probe:Drosophila_2:1636340_at:487:97; Interrogation_Position=1212; Antisense; AGATCTCCTGCCCAGTCAGATTCTG
>probe:Drosophila_2:1636340_at:485:705; Interrogation_Position=1244; Antisense; TTAGTCAGTTTCGTCAGTGGCCGGA
>probe:Drosophila_2:1636340_at:373:551; Interrogation_Position=1320; Antisense; GGAGACTGCCAATGACGAACCAAAC
>probe:Drosophila_2:1636340_at:82:203; Interrogation_Position=1342; Antisense; AACCTAGAGGATGGCGTCACGTTGC
>probe:Drosophila_2:1636340_at:75:257; Interrogation_Position=1428; Antisense; CACTCCCGTCAAGAGGCGCAGGAAA
>probe:Drosophila_2:1636340_at:415:559; Interrogation_Position=1448; Antisense; GGAAAGCCAGTTCTTAGTTGTACAT
>probe:Drosophila_2:1636340_at:670:297; Interrogation_Position=929; Antisense; CGCGCCGCAATCTTCATGAGCTGTG
>probe:Drosophila_2:1636340_at:682:607; Interrogation_Position=945; Antisense; TGAGCTGTGCCAGTCGCAGGATCTA
>probe:Drosophila_2:1636340_at:544:297; Interrogation_Position=972; Antisense; CGCTCTCTGGTTCTTCATTAAGCAG

Paste this into a BLAST search page for me
TGTGGACCTCGGCTTATCATTAATCATCATTAATCCGAAGTCCTCCGAGTAGAAACTACCACAGTACTCGTGCCACAGAAACTACTATCCCGGCATCAACGGCATCAACATCTACACACAGTTCGAGATCTCCTGCCCAGTCAGATTCTGTTAGTCAGTTTCGTCAGTGGCCGGAGGAGACTGCCAATGACGAACCAAACAACCTAGAGGATGGCGTCACGTTGCCACTCCCGTCAAGAGGCGCAGGAAAGGAAAGCCAGTTCTTAGTTGTACATCGCGCCGCAATCTTCATGAGCTGTGTGAGCTGTGCCAGTCGCAGGATCTACGCTCTCTGGTTCTTCATTAAGCAG

Full Affymetrix probeset data:

Annotations for 1636340_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720