Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636341_at:

>probe:Drosophila_2:1636341_at:301:587; Interrogation_Position=1452; Antisense; TGGACTCCAAGTCGCAGGTCTGTTC
>probe:Drosophila_2:1636341_at:724:603; Interrogation_Position=1506; Antisense; TGATCTCTGCGCATGGTTTTGCTAA
>probe:Drosophila_2:1636341_at:264:477; Interrogation_Position=1521; Antisense; GTTTTGCTAACAACCAACTGACCAT
>probe:Drosophila_2:1636341_at:373:377; Interrogation_Position=1567; Antisense; GAAGCAAGCCGATTTGACTGGACAC
>probe:Drosophila_2:1636341_at:123:407; Interrogation_Position=1582; Antisense; GACTGGACACACGTCACGAGTTCTC
>probe:Drosophila_2:1636341_at:503:137; Interrogation_Position=1597; Antisense; ACGAGTTCTCCAGATGGCCATGTCT
>probe:Drosophila_2:1636341_at:707:351; Interrogation_Position=1629; Antisense; GCAGCACAGTGATCAGCGCCGGAGC
>probe:Drosophila_2:1636341_at:47:597; Interrogation_Position=1654; Antisense; TGATGAAACCCTGCGTCTTTGGAAC
>probe:Drosophila_2:1636341_at:533:291; Interrogation_Position=1695; Antisense; CGTTGGCGTCCAAGAAGGCAGTTTC
>probe:Drosophila_2:1636341_at:645:567; Interrogation_Position=1711; Antisense; GGCAGTTTCGACCAGCAAGGGCAAA
>probe:Drosophila_2:1636341_at:613:219; Interrogation_Position=1727; Antisense; AAGGGCAAACAGAGCGTGTTCCGAC
>probe:Drosophila_2:1636341_at:273:603; Interrogation_Position=1743; Antisense; TGTTCCGACAGAGCATCCGTTGATA
>probe:Drosophila_2:1636341_at:319:47; Interrogation_Position=1757; Antisense; ATCCGTTGATATGCTCAGACCTTTA
>probe:Drosophila_2:1636341_at:531:601; Interrogation_Position=1886; Antisense; TGTTCTCGTTTAATGTTTCGTACTT

Paste this into a BLAST search page for me
TGGACTCCAAGTCGCAGGTCTGTTCTGATCTCTGCGCATGGTTTTGCTAAGTTTTGCTAACAACCAACTGACCATGAAGCAAGCCGATTTGACTGGACACGACTGGACACACGTCACGAGTTCTCACGAGTTCTCCAGATGGCCATGTCTGCAGCACAGTGATCAGCGCCGGAGCTGATGAAACCCTGCGTCTTTGGAACCGTTGGCGTCCAAGAAGGCAGTTTCGGCAGTTTCGACCAGCAAGGGCAAAAAGGGCAAACAGAGCGTGTTCCGACTGTTCCGACAGAGCATCCGTTGATAATCCGTTGATATGCTCAGACCTTTATGTTCTCGTTTAATGTTTCGTACTT

Full Affymetrix probeset data:

Annotations for 1636341_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime