FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636343_at:

>probe:Drosophila_2:1636343_at:378:681; Interrogation_Position=1013; Antisense; TATGTCCCCGTGAACAGCGAGGCAC
>probe:Drosophila_2:1636343_at:152:567; Interrogation_Position=1033; Antisense; GGCACCCTTCGGCAAGATTGAGTAG
>probe:Drosophila_2:1636343_at:401:99; Interrogation_Position=513; Antisense; AGATGATCAAGTACCTGCACGACCA
>probe:Drosophila_2:1636343_at:179:129; Interrogation_Position=537; Antisense; ACCACGGCTTGGACTACGATAGCTT
>probe:Drosophila_2:1636343_at:297:605; Interrogation_Position=567; Antisense; TGATCGGACACAGCCTGGGAGCCCA
>probe:Drosophila_2:1636343_at:148:125; Interrogation_Position=586; Antisense; AGCCCATGTTGCTGGATACGCCGGA
>probe:Drosophila_2:1636343_at:263:103; Interrogation_Position=612; Antisense; AGACCGTCGGAGACAAGCGCGTTCA
>probe:Drosophila_2:1636343_at:403:205; Interrogation_Position=626; Antisense; AAGCGCGTTCACACCATTGTGGGTC
>probe:Drosophila_2:1636343_at:607:643; Interrogation_Position=669; Antisense; TCTTCAGCTACGATAAGCCCGCTAA
>probe:Drosophila_2:1636343_at:171:339; Interrogation_Position=689; Antisense; GCTAAGCGTCTATCCACCGATGATG
>probe:Drosophila_2:1636343_at:239:59; Interrogation_Position=708; Antisense; ATGATGCCCACTACGTAGAGTCCAT
>probe:Drosophila_2:1636343_at:610:191; Interrogation_Position=740; Antisense; AACGGCGGCAAACTGGGATTCCTGA
>probe:Drosophila_2:1636343_at:18:547; Interrogation_Position=899; Antisense; GGATCCATTAAGTGCCATGACTACG
>probe:Drosophila_2:1636343_at:457:55; Interrogation_Position=915; Antisense; ATGACTACGAGGATGCCGTTGCCAA

Paste this into a BLAST search page for me
TATGTCCCCGTGAACAGCGAGGCACGGCACCCTTCGGCAAGATTGAGTAGAGATGATCAAGTACCTGCACGACCAACCACGGCTTGGACTACGATAGCTTTGATCGGACACAGCCTGGGAGCCCAAGCCCATGTTGCTGGATACGCCGGAAGACCGTCGGAGACAAGCGCGTTCAAAGCGCGTTCACACCATTGTGGGTCTCTTCAGCTACGATAAGCCCGCTAAGCTAAGCGTCTATCCACCGATGATGATGATGCCCACTACGTAGAGTCCATAACGGCGGCAAACTGGGATTCCTGAGGATCCATTAAGTGCCATGACTACGATGACTACGAGGATGCCGTTGCCAA

Full Affymetrix probeset data:

Annotations for 1636343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720