FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636344_at:

>probe:Drosophila_2:1636344_at:567:587; Interrogation_Position=4321; Antisense; TGGAGGCCCTCAAATTCGATCTGGA
>probe:Drosophila_2:1636344_at:460:521; Interrogation_Position=4404; Antisense; GTGGCCATGGTCTTCTGGATGTGAC
>probe:Drosophila_2:1636344_at:703:547; Interrogation_Position=4420; Antisense; GGATGTGACTTCTGCACTTTACATA
>probe:Drosophila_2:1636344_at:222:305; Interrogation_Position=4453; Antisense; CCACCGACTTTTATACCATTCTTGA
>probe:Drosophila_2:1636344_at:721:57; Interrogation_Position=4502; Antisense; ATGAGTCCTGCCGTCTAGAGTTTAA
>probe:Drosophila_2:1636344_at:209:443; Interrogation_Position=4531; Antisense; GATGATGAGACTTTGGCCACTTTGA
>probe:Drosophila_2:1636344_at:222:579; Interrogation_Position=4545; Antisense; GGCCACTTTGATACCTTTTGCAGTT
>probe:Drosophila_2:1636344_at:244:349; Interrogation_Position=4564; Antisense; GCAGTTAGTTGATTCTCTTCCGACA
>probe:Drosophila_2:1636344_at:519:533; Interrogation_Position=4610; Antisense; GGTCCTTGGTAACGCCTTATATGTA
>probe:Drosophila_2:1636344_at:153:281; Interrogation_Position=4681; Antisense; CTCACTGTCTATCTCCATGTATGTA
>probe:Drosophila_2:1636344_at:128:485; Interrogation_Position=4699; Antisense; GTATGTATATTCTCGTAGGCCTTAA
>probe:Drosophila_2:1636344_at:223:115; Interrogation_Position=4740; Antisense; AGCTATCTAGTAAACCGCCTGACCT
>probe:Drosophila_2:1636344_at:98:411; Interrogation_Position=4765; Antisense; GACCCACGAATACTTTCTGTACTTC
>probe:Drosophila_2:1636344_at:7:217; Interrogation_Position=4796; Antisense; AAGTTAGGTCACTGCGCTGCTTAAA

Paste this into a BLAST search page for me
TGGAGGCCCTCAAATTCGATCTGGAGTGGCCATGGTCTTCTGGATGTGACGGATGTGACTTCTGCACTTTACATACCACCGACTTTTATACCATTCTTGAATGAGTCCTGCCGTCTAGAGTTTAAGATGATGAGACTTTGGCCACTTTGAGGCCACTTTGATACCTTTTGCAGTTGCAGTTAGTTGATTCTCTTCCGACAGGTCCTTGGTAACGCCTTATATGTACTCACTGTCTATCTCCATGTATGTAGTATGTATATTCTCGTAGGCCTTAAAGCTATCTAGTAAACCGCCTGACCTGACCCACGAATACTTTCTGTACTTCAAGTTAGGTCACTGCGCTGCTTAAA

Full Affymetrix probeset data:

Annotations for 1636344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720