FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636346_at:

>probe:Drosophila_2:1636346_at:255:453; Interrogation_Position=3127; Antisense; GATCATGATTCAAGCGATGCTCCTG
>probe:Drosophila_2:1636346_at:382:447; Interrogation_Position=3142; Antisense; GATGCTCCTGAGAGTCCAGACGAAG
>probe:Drosophila_2:1636346_at:398:375; Interrogation_Position=3181; Antisense; GAAGATGCACCACCGAGATCCAAAA
>probe:Drosophila_2:1636346_at:105:547; Interrogation_Position=3235; Antisense; GGAGGACGAAGCTTTGCCAAAACAC
>probe:Drosophila_2:1636346_at:287:89; Interrogation_Position=3268; Antisense; AGTCACGATATGTCCTCTCTGTTTG
>probe:Drosophila_2:1636346_at:513:639; Interrogation_Position=3283; Antisense; TCTCTGTTTGCTGCCGCCGATGACT
>probe:Drosophila_2:1636346_at:652:55; Interrogation_Position=3302; Antisense; ATGACTTCTCTTCGCTGCTGGAGGA
>probe:Drosophila_2:1636346_at:346:81; Interrogation_Position=3347; Antisense; AGGGAACCAGCAATGCCGTCTTTAA
>probe:Drosophila_2:1636346_at:29:75; Interrogation_Position=3374; Antisense; AGGACAAGTCCTCCGACAAACAATT
>probe:Drosophila_2:1636346_at:362:409; Interrogation_Position=3416; Antisense; GACGATCGAACTCCAAATCCTACAA
>probe:Drosophila_2:1636346_at:424:525; Interrogation_Position=3441; Antisense; GGGCAAGAAGTTCGCCGGCAAACCA
>probe:Drosophila_2:1636346_at:261:73; Interrogation_Position=3462; Antisense; ACCAGCGGCCAAAGGCGGTAGACCA
>probe:Drosophila_2:1636346_at:710:327; Interrogation_Position=3476; Antisense; GCGGTAGACCACAGAAAGCGGGCAA
>probe:Drosophila_2:1636346_at:683:145; Interrogation_Position=3522; Antisense; ACTCGATTATCAAACTCTACTCCAT

Paste this into a BLAST search page for me
GATCATGATTCAAGCGATGCTCCTGGATGCTCCTGAGAGTCCAGACGAAGGAAGATGCACCACCGAGATCCAAAAGGAGGACGAAGCTTTGCCAAAACACAGTCACGATATGTCCTCTCTGTTTGTCTCTGTTTGCTGCCGCCGATGACTATGACTTCTCTTCGCTGCTGGAGGAAGGGAACCAGCAATGCCGTCTTTAAAGGACAAGTCCTCCGACAAACAATTGACGATCGAACTCCAAATCCTACAAGGGCAAGAAGTTCGCCGGCAAACCAACCAGCGGCCAAAGGCGGTAGACCAGCGGTAGACCACAGAAAGCGGGCAAACTCGATTATCAAACTCTACTCCAT

Full Affymetrix probeset data:

Annotations for 1636346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720