Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636347_at:

>probe:Drosophila_2:1636347_at:589:517; Interrogation_Position=2091; Antisense; GTGGTCACTAAGGTTACCGATACGC
>probe:Drosophila_2:1636347_at:153:673; Interrogation_Position=2105; Antisense; TACCGATACGCAGAAGCATCAGCAT
>probe:Drosophila_2:1636347_at:382:179; Interrogation_Position=2190; Antisense; AAACATCTAGCGGACTTGGCTTGTT
>probe:Drosophila_2:1636347_at:265:403; Interrogation_Position=2202; Antisense; GACTTGGCTTGTTTCAATCGAACGT
>probe:Drosophila_2:1636347_at:683:191; Interrogation_Position=2316; Antisense; AACTATACTCCTTGCTTAAGTCGCG
>probe:Drosophila_2:1636347_at:42:343; Interrogation_Position=2329; Antisense; GCTTAAGTCGCGCACCGAAAATTTT
>probe:Drosophila_2:1636347_at:247:361; Interrogation_Position=2396; Antisense; GCAAGTTCCCTTTTCAAACATTGTG
>probe:Drosophila_2:1636347_at:380:191; Interrogation_Position=2412; Antisense; AACATTGTGAGGTGCGAGCCCACTC
>probe:Drosophila_2:1636347_at:172:637; Interrogation_Position=2435; Antisense; TCGAATTCACTTTTCACCTTCACAA
>probe:Drosophila_2:1636347_at:325:257; Interrogation_Position=2466; Antisense; CACACTACTACACCGCCATAAATTA
>probe:Drosophila_2:1636347_at:597:341; Interrogation_Position=2518; Antisense; GCTTTTCGTTTATTGTTACGCCAAG
>probe:Drosophila_2:1636347_at:59:709; Interrogation_Position=2533; Antisense; TTACGCCAAGTCTCTGCAAAGCCAA
>probe:Drosophila_2:1636347_at:57:203; Interrogation_Position=2551; Antisense; AAGCCAAATCCACACTTAGTCTAAG
>probe:Drosophila_2:1636347_at:118:477; Interrogation_Position=2595; Antisense; GTTTTCGATCCAATAACGCATTTAT

Paste this into a BLAST search page for me
GTGGTCACTAAGGTTACCGATACGCTACCGATACGCAGAAGCATCAGCATAAACATCTAGCGGACTTGGCTTGTTGACTTGGCTTGTTTCAATCGAACGTAACTATACTCCTTGCTTAAGTCGCGGCTTAAGTCGCGCACCGAAAATTTTGCAAGTTCCCTTTTCAAACATTGTGAACATTGTGAGGTGCGAGCCCACTCTCGAATTCACTTTTCACCTTCACAACACACTACTACACCGCCATAAATTAGCTTTTCGTTTATTGTTACGCCAAGTTACGCCAAGTCTCTGCAAAGCCAAAAGCCAAATCCACACTTAGTCTAAGGTTTTCGATCCAATAACGCATTTAT

Full Affymetrix probeset data:

Annotations for 1636347_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime