Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636349_at:

>probe:Drosophila_2:1636349_at:359:285; Interrogation_Position=1139; Antisense; CTGTTCAGCCTAAGCCTTTGGGTAA
>probe:Drosophila_2:1636349_at:337:59; Interrogation_Position=1265; Antisense; ATGTTGAGCCCGGTATTCGCAAGCA
>probe:Drosophila_2:1636349_at:597:147; Interrogation_Position=1312; Antisense; ACTTCCTTTAAGTCCAGTGGCTATA
>probe:Drosophila_2:1636349_at:71:75; Interrogation_Position=1349; Antisense; AGGAGCATTCTAGCTACCGCAAATC
>probe:Drosophila_2:1636349_at:410:175; Interrogation_Position=1391; Antisense; AAACCAAGTCATCGTCCACTATGGG
>probe:Drosophila_2:1636349_at:387:247; Interrogation_Position=1439; Antisense; AATTCCCGAAATTGCAGCCTGAGCC
>probe:Drosophila_2:1636349_at:315:567; Interrogation_Position=1467; Antisense; GGCACCGATTTACTTCACGGCGAAG
>probe:Drosophila_2:1636349_at:455:535; Interrogation_Position=1515; Antisense; GGTGCCACCATCTCAATCGAATGTT
>probe:Drosophila_2:1636349_at:346:541; Interrogation_Position=1557; Antisense; GGTTCGGATTAGATCTTCTCTGTGT
>probe:Drosophila_2:1636349_at:673:513; Interrogation_Position=1578; Antisense; GTGTCTATCTGTGTGTCGTTACTAT
>probe:Drosophila_2:1636349_at:430:599; Interrogation_Position=1603; Antisense; TGTCGTTCATTGTCGTTGTTGCTAG
>probe:Drosophila_2:1636349_at:446:255; Interrogation_Position=1639; Antisense; CAAAAGATTGCTCCCATTTACACCA
>probe:Drosophila_2:1636349_at:641:187; Interrogation_Position=1667; Antisense; AACAGCCTCTGTATCGTTGTTGTTC
>probe:Drosophila_2:1636349_at:588:467; Interrogation_Position=1682; Antisense; GTTGTTGTTCCCATCAGCTAACTAG

Paste this into a BLAST search page for me
CTGTTCAGCCTAAGCCTTTGGGTAAATGTTGAGCCCGGTATTCGCAAGCAACTTCCTTTAAGTCCAGTGGCTATAAGGAGCATTCTAGCTACCGCAAATCAAACCAAGTCATCGTCCACTATGGGAATTCCCGAAATTGCAGCCTGAGCCGGCACCGATTTACTTCACGGCGAAGGGTGCCACCATCTCAATCGAATGTTGGTTCGGATTAGATCTTCTCTGTGTGTGTCTATCTGTGTGTCGTTACTATTGTCGTTCATTGTCGTTGTTGCTAGCAAAAGATTGCTCCCATTTACACCAAACAGCCTCTGTATCGTTGTTGTTCGTTGTTGTTCCCATCAGCTAACTAG

Full Affymetrix probeset data:

Annotations for 1636349_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime