FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636351_at:

>probe:Drosophila_2:1636351_at:191:393; Interrogation_Position=177; Antisense; GAAAGCCCTGAAATCGTGCAACTTA
>probe:Drosophila_2:1636351_at:577:285; Interrogation_Position=206; Antisense; CGGCCAAATGGGTGTTTTTCTTCTG
>probe:Drosophila_2:1636351_at:657:475; Interrogation_Position=219; Antisense; GTTTTTCTTCTGTGACGAGCGGTAT
>probe:Drosophila_2:1636351_at:654:295; Interrogation_Position=234; Antisense; CGAGCGGTATGTTCGCCTGGATGAC
>probe:Drosophila_2:1636351_at:316:445; Interrogation_Position=253; Antisense; GATGACAGCGATTCCACCTATGGTG
>probe:Drosophila_2:1636351_at:455:613; Interrogation_Position=280; Antisense; TACAGGGCCGAGTGGCTAACCCAAT
>probe:Drosophila_2:1636351_at:285:495; Interrogation_Position=388; Antisense; GTCAAAAGTCAAGTCGATCGCTTCG
>probe:Drosophila_2:1636351_at:22:41; Interrogation_Position=413; Antisense; ATCTGCTGCTGCTTGGCATGGGACC
>probe:Drosophila_2:1636351_at:356:135; Interrogation_Position=576; Antisense; ACGGAATGTCGCCTTCGTGGTTACG
>probe:Drosophila_2:1636351_at:103:707; Interrogation_Position=596; Antisense; TTACGGGCGCCGCAAAAGCCAGTGT
>probe:Drosophila_2:1636351_at:579:203; Interrogation_Position=611; Antisense; AAGCCAGTGTCGTCAAGAGTGTGTT
>probe:Drosophila_2:1636351_at:721:251; Interrogation_Position=624; Antisense; CAAGAGTGTGTTTGTCGATCTGGAC
>probe:Drosophila_2:1636351_at:58:587; Interrogation_Position=644; Antisense; TGGACAAGAAGTTTCCCGCTGCGTG
>probe:Drosophila_2:1636351_at:728:295; Interrogation_Position=660; Antisense; CGCTGCGTGGGTGAATCCGACCAAA

Paste this into a BLAST search page for me
GAAAGCCCTGAAATCGTGCAACTTACGGCCAAATGGGTGTTTTTCTTCTGGTTTTTCTTCTGTGACGAGCGGTATCGAGCGGTATGTTCGCCTGGATGACGATGACAGCGATTCCACCTATGGTGTACAGGGCCGAGTGGCTAACCCAATGTCAAAAGTCAAGTCGATCGCTTCGATCTGCTGCTGCTTGGCATGGGACCACGGAATGTCGCCTTCGTGGTTACGTTACGGGCGCCGCAAAAGCCAGTGTAAGCCAGTGTCGTCAAGAGTGTGTTCAAGAGTGTGTTTGTCGATCTGGACTGGACAAGAAGTTTCCCGCTGCGTGCGCTGCGTGGGTGAATCCGACCAAA

Full Affymetrix probeset data:

Annotations for 1636351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720