FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636352_at:

>probe:Drosophila_2:1636352_at:49:111; Interrogation_Position=1175; Antisense; AGAATCTGCCTGAGAAGCTCCACGG
>probe:Drosophila_2:1636352_at:615:125; Interrogation_Position=1202; Antisense; AGCCTGCCAGCGAGTACTTCATGTA
>probe:Drosophila_2:1636352_at:196:703; Interrogation_Position=1267; Antisense; TTAGATGCTCAACAGGCCGAATGCC
>probe:Drosophila_2:1636352_at:316:295; Interrogation_Position=1284; Antisense; CGAATGCCTGGTGCGTTTCTTTGAA
>probe:Drosophila_2:1636352_at:398:697; Interrogation_Position=1299; Antisense; TTTCTTTGAAGCCACCTTAGCATCG
>probe:Drosophila_2:1636352_at:82:135; Interrogation_Position=1349; Antisense; ACGCCGTGCGTGTAATGACCAATCT
>probe:Drosophila_2:1636352_at:56:239; Interrogation_Position=1369; Antisense; AATCTGGTAGCCCTAGGTGACACAA
>probe:Drosophila_2:1636352_at:16:643; Interrogation_Position=1395; Antisense; TCTAATATTCGCACTGGCAGACCCG
>probe:Drosophila_2:1636352_at:207:567; Interrogation_Position=1410; Antisense; GGCAGACCCGCAGAATCTTGTGCAA
>probe:Drosophila_2:1636352_at:139:727; Interrogation_Position=1427; Antisense; TTGTGCAAACCCTAAACCAGCTCTT
>probe:Drosophila_2:1636352_at:29:557; Interrogation_Position=1479; Antisense; GGACGCGATGCGCTTGCTCAAGAAC
>probe:Drosophila_2:1636352_at:19:203; Interrogation_Position=1531; Antisense; AACCTGGTACTGAATAGCTTGCAAA
>probe:Drosophila_2:1636352_at:637:199; Interrogation_Position=1629; Antisense; AAGCCACGGACTTTTGAGTACTCGA
>probe:Drosophila_2:1636352_at:729:231; Interrogation_Position=1666; Antisense; AATGAACATGGATTGCCGCTAAGCA

Paste this into a BLAST search page for me
AGAATCTGCCTGAGAAGCTCCACGGAGCCTGCCAGCGAGTACTTCATGTATTAGATGCTCAACAGGCCGAATGCCCGAATGCCTGGTGCGTTTCTTTGAATTTCTTTGAAGCCACCTTAGCATCGACGCCGTGCGTGTAATGACCAATCTAATCTGGTAGCCCTAGGTGACACAATCTAATATTCGCACTGGCAGACCCGGGCAGACCCGCAGAATCTTGTGCAATTGTGCAAACCCTAAACCAGCTCTTGGACGCGATGCGCTTGCTCAAGAACAACCTGGTACTGAATAGCTTGCAAAAAGCCACGGACTTTTGAGTACTCGAAATGAACATGGATTGCCGCTAAGCA

Full Affymetrix probeset data:

Annotations for 1636352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720