FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636354_at:

>probe:Drosophila_2:1636354_at:31:191; Interrogation_Position=2139; Antisense; AACTTGCGGCGCACGAGCACTGAAT
>probe:Drosophila_2:1636354_at:64:113; Interrogation_Position=2154; Antisense; AGCACTGAATTCACCTCGAAGGACT
>probe:Drosophila_2:1636354_at:352:585; Interrogation_Position=2183; Antisense; TGTAAACATCCGAAAGGCCCTCGTG
>probe:Drosophila_2:1636354_at:482:81; Interrogation_Position=2209; Antisense; AGGGCTTCTTCATGCAGGTGGCCCA
>probe:Drosophila_2:1636354_at:200:259; Interrogation_Position=2243; Antisense; CACTGGCTACTATCTGACCATCAAG
>probe:Drosophila_2:1636354_at:445:559; Interrogation_Position=2267; Antisense; GGACAACCAGAACGTGCAGCTGCAT
>probe:Drosophila_2:1636354_at:595:119; Interrogation_Position=2284; Antisense; AGCTGCATCCGTCGACTTGTCTCGA
>probe:Drosophila_2:1636354_at:342:205; Interrogation_Position=2313; Antisense; AAGCCCGATTGGGTCATCTACAATG
>probe:Drosophila_2:1636354_at:596:663; Interrogation_Position=2331; Antisense; TACAATGAGTTCGTGCTGACTACAA
>probe:Drosophila_2:1636354_at:483:211; Interrogation_Position=2355; Antisense; AAGAACTACATTCGCACGGTGACAG
>probe:Drosophila_2:1636354_at:108:203; Interrogation_Position=2386; Antisense; AACCTGAATGGTTGTGCTGCCTGGC
>probe:Drosophila_2:1636354_at:264:287; Interrogation_Position=2406; Antisense; CTGGCGCCCCAATATTATGACTTGA
>probe:Drosophila_2:1636354_at:351:177; Interrogation_Position=2454; Antisense; AAACGACAGCTGGAGTTGTTGCAAC
>probe:Drosophila_2:1636354_at:68:239; Interrogation_Position=2665; Antisense; AATAATATCCAAGAACTCCGTTTAG

Paste this into a BLAST search page for me
AACTTGCGGCGCACGAGCACTGAATAGCACTGAATTCACCTCGAAGGACTTGTAAACATCCGAAAGGCCCTCGTGAGGGCTTCTTCATGCAGGTGGCCCACACTGGCTACTATCTGACCATCAAGGGACAACCAGAACGTGCAGCTGCATAGCTGCATCCGTCGACTTGTCTCGAAAGCCCGATTGGGTCATCTACAATGTACAATGAGTTCGTGCTGACTACAAAAGAACTACATTCGCACGGTGACAGAACCTGAATGGTTGTGCTGCCTGGCCTGGCGCCCCAATATTATGACTTGAAAACGACAGCTGGAGTTGTTGCAACAATAATATCCAAGAACTCCGTTTAG

Full Affymetrix probeset data:

Annotations for 1636354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720