FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636356_at:

>probe:Drosophila_2:1636356_at:400:377; Interrogation_Position=1018; Antisense; GAAGCACATTAAAGAAAGCAGCATT
>probe:Drosophila_2:1636356_at:684:93; Interrogation_Position=722; Antisense; AGATCGAATTTCGACAAGGCGATTG
>probe:Drosophila_2:1636356_at:315:251; Interrogation_Position=736; Antisense; CAAGGCGATTGGAGCCATCAGGAAT
>probe:Drosophila_2:1636356_at:363:315; Interrogation_Position=749; Antisense; GCCATCAGGAATAGGGCTCCCAAGT
>probe:Drosophila_2:1636356_at:300:613; Interrogation_Position=850; Antisense; TGAACATCTTATGTTCTGCTCCCCA
>probe:Drosophila_2:1636356_at:566:37; Interrogation_Position=855; Antisense; ATCTTATGTTCTGCTCCCCAGTCGT
>probe:Drosophila_2:1636356_at:354:309; Interrogation_Position=872; Antisense; CCAGTCGTCCGTCTATAGGCTATGA
>probe:Drosophila_2:1636356_at:713:291; Interrogation_Position=877; Antisense; CGTCCGTCTATAGGCTATGAGTATA
>probe:Drosophila_2:1636356_at:687:175; Interrogation_Position=946; Antisense; AAACGTGGATATCCGTATCCAAGTA
>probe:Drosophila_2:1636356_at:719:43; Interrogation_Position=956; Antisense; ATCCGTATCCAAGTATAAGCCCAAT
>probe:Drosophila_2:1636356_at:283:31; Interrogation_Position=970; Antisense; ATAAGCCCAATCCTGCTATGTGGAC
>probe:Drosophila_2:1636356_at:538:123; Interrogation_Position=973; Antisense; AGCCCAATCCTGCTATGTGGACTGA
>probe:Drosophila_2:1636356_at:290:305; Interrogation_Position=981; Antisense; CCTGCTATGTGGACTGACTGAGTTT
>probe:Drosophila_2:1636356_at:473:405; Interrogation_Position=996; Antisense; GACTGAGTTTATACAATCCAAGGAA

Paste this into a BLAST search page for me
GAAGCACATTAAAGAAAGCAGCATTAGATCGAATTTCGACAAGGCGATTGCAAGGCGATTGGAGCCATCAGGAATGCCATCAGGAATAGGGCTCCCAAGTTGAACATCTTATGTTCTGCTCCCCAATCTTATGTTCTGCTCCCCAGTCGTCCAGTCGTCCGTCTATAGGCTATGACGTCCGTCTATAGGCTATGAGTATAAAACGTGGATATCCGTATCCAAGTAATCCGTATCCAAGTATAAGCCCAATATAAGCCCAATCCTGCTATGTGGACAGCCCAATCCTGCTATGTGGACTGACCTGCTATGTGGACTGACTGAGTTTGACTGAGTTTATACAATCCAAGGAA

Full Affymetrix probeset data:

Annotations for 1636356_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720