FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636357_at:

>probe:Drosophila_2:1636357_at:86:535; Interrogation_Position=1002; Antisense; GGTGCTTCAAGATACGGTCAGTCAT
>probe:Drosophila_2:1636357_at:173:529; Interrogation_Position=1049; Antisense; GGGATGTCTTTAGCCTGAATATTAG
>probe:Drosophila_2:1636357_at:644:169; Interrogation_Position=1095; Antisense; AAAGGATCGCCAGCCTGAGGATCGT
>probe:Drosophila_2:1636357_at:345:607; Interrogation_Position=1110; Antisense; TGAGGATCGTGTGCCACGCAGGCCT
>probe:Drosophila_2:1636357_at:53:541; Interrogation_Position=1150; Antisense; GGTTTCCGGCGCAATGAGATCATCC
>probe:Drosophila_2:1636357_at:425:527; Interrogation_Position=1302; Antisense; GGGAAATCTGTAGACCCAACATACC
>probe:Drosophila_2:1636357_at:286:309; Interrogation_Position=1317; Antisense; CCAACATACCCAATTTACTTTCACT
>probe:Drosophila_2:1636357_at:251:699; Interrogation_Position=1369; Antisense; TTTATAAGGCATTTTGGTCTCTCAA
>probe:Drosophila_2:1636357_at:394:151; Interrogation_Position=1412; Antisense; ACATTATAGTGTTCTGCAGTAGCAG
>probe:Drosophila_2:1636357_at:729:371; Interrogation_Position=852; Antisense; GAAGGATGCACTCTCGCGGAAGAAC
>probe:Drosophila_2:1636357_at:263:497; Interrogation_Position=884; Antisense; GTCCTTTGTTCCGAAAGAGCGCCAA
>probe:Drosophila_2:1636357_at:517:227; Interrogation_Position=913; Antisense; AAGGCGTCCAAGGAGCAGTCGCGCA
>probe:Drosophila_2:1636357_at:168:203; Interrogation_Position=941; Antisense; AACCGGAGCGAGAGATTCGGCCACT
>probe:Drosophila_2:1636357_at:52:555; Interrogation_Position=987; Antisense; GGAGCGGATACCCAAGGTGCTTCAA

Paste this into a BLAST search page for me
GGTGCTTCAAGATACGGTCAGTCATGGGATGTCTTTAGCCTGAATATTAGAAAGGATCGCCAGCCTGAGGATCGTTGAGGATCGTGTGCCACGCAGGCCTGGTTTCCGGCGCAATGAGATCATCCGGGAAATCTGTAGACCCAACATACCCCAACATACCCAATTTACTTTCACTTTTATAAGGCATTTTGGTCTCTCAAACATTATAGTGTTCTGCAGTAGCAGGAAGGATGCACTCTCGCGGAAGAACGTCCTTTGTTCCGAAAGAGCGCCAAAAGGCGTCCAAGGAGCAGTCGCGCAAACCGGAGCGAGAGATTCGGCCACTGGAGCGGATACCCAAGGTGCTTCAA

Full Affymetrix probeset data:

Annotations for 1636357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720