Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636358_a_at:

>probe:Drosophila_2:1636358_a_at:606:385; Interrogation_Position=255; Antisense; GAACAGTTATCTCCTTGCAATCATT
>probe:Drosophila_2:1636358_a_at:56:39; Interrogation_Position=263; Antisense; ATCTCCTTGCAATCATTTCTATGTA
>probe:Drosophila_2:1636358_a_at:321:695; Interrogation_Position=278; Antisense; TTTCTATGTAATTCTGACGCTCCAG
>probe:Drosophila_2:1636358_a_at:578:245; Interrogation_Position=287; Antisense; AATTCTGACGCTCCAGTCGGAACAA
>probe:Drosophila_2:1636358_a_at:229:265; Interrogation_Position=300; Antisense; CAGTCGGAACAACCCAAGTCTCAAA
>probe:Drosophila_2:1636358_a_at:224:371; Interrogation_Position=363; Antisense; GAAGTGGTACATTGCCGTTGGTTTA
>probe:Drosophila_2:1636358_a_at:596:7; Interrogation_Position=373; Antisense; ATTGCCGTTGGTTTATCAGCTTCCA
>probe:Drosophila_2:1636358_a_at:429:253; Interrogation_Position=396; Antisense; CAACCGCTCCGAGGGCAAATCGGAT
>probe:Drosophila_2:1636358_a_at:345:459; Interrogation_Position=418; Antisense; GATATTCGACGATAATTCTATTCCT
>probe:Drosophila_2:1636358_a_at:404:11; Interrogation_Position=432; Antisense; ATTCTATTCCTCATAAAGCCCCATT
>probe:Drosophila_2:1636358_a_at:538:205; Interrogation_Position=447; Antisense; AAGCCCCATTTATTGCTTATATCAA
>probe:Drosophila_2:1636358_a_at:597:443; Interrogation_Position=497; Antisense; GATGACCTCTACGAGTTCTTTGAAG
>probe:Drosophila_2:1636358_a_at:423:227; Interrogation_Position=566; Antisense; AATGGTCGTTCCAGAGGCTTTGGCT
>probe:Drosophila_2:1636358_a_at:401:541; Interrogation_Position=613; Antisense; GGATTTAATTCATGTACTTAGCTTG

Paste this into a BLAST search page for me
GAACAGTTATCTCCTTGCAATCATTATCTCCTTGCAATCATTTCTATGTATTTCTATGTAATTCTGACGCTCCAGAATTCTGACGCTCCAGTCGGAACAACAGTCGGAACAACCCAAGTCTCAAAGAAGTGGTACATTGCCGTTGGTTTAATTGCCGTTGGTTTATCAGCTTCCACAACCGCTCCGAGGGCAAATCGGATGATATTCGACGATAATTCTATTCCTATTCTATTCCTCATAAAGCCCCATTAAGCCCCATTTATTGCTTATATCAAGATGACCTCTACGAGTTCTTTGAAGAATGGTCGTTCCAGAGGCTTTGGCTGGATTTAATTCATGTACTTAGCTTG

Full Affymetrix probeset data:

Annotations for 1636358_a_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime