Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636362_at:

>probe:Drosophila_2:1636362_at:661:389; Interrogation_Position=1008; Antisense; GAAACTGTCGCACTTATTTGGCTAC
>probe:Drosophila_2:1636362_at:148:323; Interrogation_Position=1033; Antisense; GCGCTAGTTTCGCATATTTCACTGT
>probe:Drosophila_2:1636362_at:598:199; Interrogation_Position=1085; Antisense; AACGCGGCGGCATCTTTGCAATTAA
>probe:Drosophila_2:1636362_at:713:61; Interrogation_Position=1172; Antisense; ATGTCGTGTTACCTGTTCTGTTCTC
>probe:Drosophila_2:1636362_at:534:601; Interrogation_Position=1190; Antisense; TGTTCTCTTTGGTTCGGCTCGTTTA
>probe:Drosophila_2:1636362_at:1:631; Interrogation_Position=1220; Antisense; TCCTGTCCTGGCAGCTTAGTGTCAA
>probe:Drosophila_2:1636362_at:211:425; Interrogation_Position=1258; Antisense; GAGACTCGCACATTTTCTCTGAGTG
>probe:Drosophila_2:1636362_at:605:607; Interrogation_Position=1277; Antisense; TGAGTGTGTCCATGTATCCTGCGTC
>probe:Drosophila_2:1636362_at:422:411; Interrogation_Position=1364; Antisense; GACGCTTTCACTGTCGACATTTTAA
>probe:Drosophila_2:1636362_at:655:709; Interrogation_Position=1385; Antisense; TTAATGCCTTTTCTTGCCGAACAGA
>probe:Drosophila_2:1636362_at:446:499; Interrogation_Position=1479; Antisense; GTCGAAAGTCCGGAGCAAGCTGCTG
>probe:Drosophila_2:1636362_at:177:205; Interrogation_Position=1517; Antisense; AAGCCATTGCAATTGCTGACGGCAC
>probe:Drosophila_2:1636362_at:426:567; Interrogation_Position=1537; Antisense; GGCACAGGATATTACCGCCGTCATT
>probe:Drosophila_2:1636362_at:573:647; Interrogation_Position=1561; Antisense; TCATCGACATCGCATTCATATTCCT

Paste this into a BLAST search page for me
GAAACTGTCGCACTTATTTGGCTACGCGCTAGTTTCGCATATTTCACTGTAACGCGGCGGCATCTTTGCAATTAAATGTCGTGTTACCTGTTCTGTTCTCTGTTCTCTTTGGTTCGGCTCGTTTATCCTGTCCTGGCAGCTTAGTGTCAAGAGACTCGCACATTTTCTCTGAGTGTGAGTGTGTCCATGTATCCTGCGTCGACGCTTTCACTGTCGACATTTTAATTAATGCCTTTTCTTGCCGAACAGAGTCGAAAGTCCGGAGCAAGCTGCTGAAGCCATTGCAATTGCTGACGGCACGGCACAGGATATTACCGCCGTCATTTCATCGACATCGCATTCATATTCCT

Full Affymetrix probeset data:

Annotations for 1636362_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime