Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636363_s_at:

>probe:Drosophila_2:1636363_s_at:167:367; Interrogation_Position=1025; Antisense; GAATCGGCTGCATCAGTGAATGCCA
>probe:Drosophila_2:1636363_s_at:373:265; Interrogation_Position=1074; Antisense; CAGACGAGTCGCAAGTCAGAGGCAA
>probe:Drosophila_2:1636363_s_at:199:537; Interrogation_Position=1115; Antisense; GGTTAAAACCCTGATCTGTCGGTAT
>probe:Drosophila_2:1636363_s_at:373:39; Interrogation_Position=1128; Antisense; ATCTGTCGGTATAGCGTCTTTGTAC
>probe:Drosophila_2:1636363_s_at:512:443; Interrogation_Position=730; Antisense; GATGTTGCCATCGTTAAATTTCCTA
>probe:Drosophila_2:1636363_s_at:140:65; Interrogation_Position=756; Antisense; ATGGATTTGATTGCAACGACGAGGA
>probe:Drosophila_2:1636363_s_at:171:81; Interrogation_Position=780; Antisense; AGGTGCAATCTGATGGCGATGATGA
>probe:Drosophila_2:1636363_s_at:340:435; Interrogation_Position=809; Antisense; GAGGTCAACGGCAACGATTCCGACG
>probe:Drosophila_2:1636363_s_at:438:461; Interrogation_Position=824; Antisense; GATTCCGACGAAGTGGGAGTTTCCG
>probe:Drosophila_2:1636363_s_at:611:589; Interrogation_Position=837; Antisense; TGGGAGTTTCCGACGAAGATGACGA
>probe:Drosophila_2:1636363_s_at:449:69; Interrogation_Position=882; Antisense; AGGCGAATGGTGAAGTGTCCCTGTC
>probe:Drosophila_2:1636363_s_at:722:371; Interrogation_Position=893; Antisense; GAAGTGTCCCTGTCGGAGGTGTACA
>probe:Drosophila_2:1636363_s_at:583:453; Interrogation_Position=935; Antisense; GATAACTCTGATTGGGAAGGCGAAG
>probe:Drosophila_2:1636363_s_at:537:463; Interrogation_Position=989; Antisense; GATTCCGATATTGATGATGCCGATG

Paste this into a BLAST search page for me
GAATCGGCTGCATCAGTGAATGCCACAGACGAGTCGCAAGTCAGAGGCAAGGTTAAAACCCTGATCTGTCGGTATATCTGTCGGTATAGCGTCTTTGTACGATGTTGCCATCGTTAAATTTCCTAATGGATTTGATTGCAACGACGAGGAAGGTGCAATCTGATGGCGATGATGAGAGGTCAACGGCAACGATTCCGACGGATTCCGACGAAGTGGGAGTTTCCGTGGGAGTTTCCGACGAAGATGACGAAGGCGAATGGTGAAGTGTCCCTGTCGAAGTGTCCCTGTCGGAGGTGTACAGATAACTCTGATTGGGAAGGCGAAGGATTCCGATATTGATGATGCCGATG

Full Affymetrix probeset data:

Annotations for 1636363_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime