Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636364_a_at:

>probe:Drosophila_2:1636364_a_at:604:397; Interrogation_Position=100; Antisense; GACAAACTCAACATGTGCAACGGAT
>probe:Drosophila_2:1636364_a_at:496:269; Interrogation_Position=111; Antisense; CATGTGCAACGGATGTGGATGCTGT
>probe:Drosophila_2:1636364_a_at:269:553; Interrogation_Position=20; Antisense; GGACCAGTCGCTTCGACTTCTAAAT
>probe:Drosophila_2:1636364_a_at:287:595; Interrogation_Position=295; Antisense; TGTGGCTTCTAAGCGGCTCTGTTAC
>probe:Drosophila_2:1636364_a_at:427:659; Interrogation_Position=304; Antisense; TAAGCGGCTCTGTTACTACGGACGA
>probe:Drosophila_2:1636364_a_at:534:61; Interrogation_Position=313; Antisense; CTGTTACTACGGACGACCCATATAA
>probe:Drosophila_2:1636364_a_at:254:409; Interrogation_Position=324; Antisense; GACGACCCATATAAGCGGCGGAACT
>probe:Drosophila_2:1636364_a_at:34:331; Interrogation_Position=341; Antisense; GCGGAACTGAGAACCGTTGGACCAT
>probe:Drosophila_2:1636364_a_at:191:123; Interrogation_Position=353; Antisense; ACCGTTGGACCATGTTGTGTAACAC
>probe:Drosophila_2:1636364_a_at:648:187; Interrogation_Position=373; Antisense; AACACGTTTTGGTTAGCAACTCGAT
>probe:Drosophila_2:1636364_a_at:234:475; Interrogation_Position=384; Antisense; GTTAGCAACTCGATCGGATGCATCT
>probe:Drosophila_2:1636364_a_at:473:451; Interrogation_Position=395; Antisense; GATCGGATGCATCTATCACCAATAT
>probe:Drosophila_2:1636364_a_at:424:261; Interrogation_Position=411; Antisense; CACCAATATGCAGATTTTTAGGCTT
>probe:Drosophila_2:1636364_a_at:211:667; Interrogation_Position=65; Antisense; TACTTTTTCGATAATAACTCAACCA

Paste this into a BLAST search page for me
GACAAACTCAACATGTGCAACGGATCATGTGCAACGGATGTGGATGCTGTGGACCAGTCGCTTCGACTTCTAAATTGTGGCTTCTAAGCGGCTCTGTTACTAAGCGGCTCTGTTACTACGGACGACTGTTACTACGGACGACCCATATAAGACGACCCATATAAGCGGCGGAACTGCGGAACTGAGAACCGTTGGACCATACCGTTGGACCATGTTGTGTAACACAACACGTTTTGGTTAGCAACTCGATGTTAGCAACTCGATCGGATGCATCTGATCGGATGCATCTATCACCAATATCACCAATATGCAGATTTTTAGGCTTTACTTTTTCGATAATAACTCAACCA

Full Affymetrix probeset data:

Annotations for 1636364_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime