FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636367_at:

>probe:Drosophila_2:1636367_at:474:487; Interrogation_Position=1028; Antisense; GTACTTTATCCCCAAGTATCCGCTA
>probe:Drosophila_2:1636367_at:554:339; Interrogation_Position=1049; Antisense; GCTACACCAACTTGCCATTAACTAA
>probe:Drosophila_2:1636367_at:706:169; Interrogation_Position=1072; Antisense; AAAGGCAACCACATCTTGGACTCAC
>probe:Drosophila_2:1636367_at:332:273; Interrogation_Position=1086; Antisense; CTTGGACTCACTCAACCTGTTTAAA
>probe:Drosophila_2:1636367_at:185:605; Interrogation_Position=1125; Antisense; TGATCATGATCAGTCTTCGTACGAG
>probe:Drosophila_2:1636367_at:654:523; Interrogation_Position=686; Antisense; GGGCGTCACTTTTGGTAGACATTTC
>probe:Drosophila_2:1636367_at:547:485; Interrogation_Position=700; Antisense; GTAGACATTTCTTCGACACCCGTTT
>probe:Drosophila_2:1636367_at:372:293; Interrogation_Position=720; Antisense; CGTTTCGCCGTAGCTAGGCATGAAA
>probe:Drosophila_2:1636367_at:472:591; Interrogation_Position=758; Antisense; TGTGGATCCGAAACCGGTCCGTAAT
>probe:Drosophila_2:1636367_at:306:169; Interrogation_Position=793; Antisense; AAATGGACAATCTGACCACCGTCTG
>probe:Drosophila_2:1636367_at:260:607; Interrogation_Position=865; Antisense; TGATGCGCCACGTCTACAGCATAAA
>probe:Drosophila_2:1636367_at:492:419; Interrogation_Position=951; Antisense; GAGCAGTGCCACAATGAGTCCTACA
>probe:Drosophila_2:1636367_at:620:503; Interrogation_Position=968; Antisense; GTCCTACACTGACTGGTTGGAGTAC
>probe:Drosophila_2:1636367_at:649:429; Interrogation_Position=987; Antisense; GAGTACCAGGAGTGCGCCATTAGAC

Paste this into a BLAST search page for me
GTACTTTATCCCCAAGTATCCGCTAGCTACACCAACTTGCCATTAACTAAAAAGGCAACCACATCTTGGACTCACCTTGGACTCACTCAACCTGTTTAAATGATCATGATCAGTCTTCGTACGAGGGGCGTCACTTTTGGTAGACATTTCGTAGACATTTCTTCGACACCCGTTTCGTTTCGCCGTAGCTAGGCATGAAATGTGGATCCGAAACCGGTCCGTAATAAATGGACAATCTGACCACCGTCTGTGATGCGCCACGTCTACAGCATAAAGAGCAGTGCCACAATGAGTCCTACAGTCCTACACTGACTGGTTGGAGTACGAGTACCAGGAGTGCGCCATTAGAC

Full Affymetrix probeset data:

Annotations for 1636367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720