FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636368_at:

>probe:Drosophila_2:1636368_at:6:497; Interrogation_Position=159; Antisense; GTCAGTTCCGGCTATGCGATCTACA
>probe:Drosophila_2:1636368_at:352:681; Interrogation_Position=207; Antisense; TATGGCTATGCAACAGCGGCCTTGA
>probe:Drosophila_2:1636368_at:170:37; Interrogation_Position=318; Antisense; ATCATGGAGATAGTACCGCTGCCCC
>probe:Drosophila_2:1636368_at:185:419; Interrogation_Position=354; Antisense; GAGCTGTATCTGAAGTCCACCAATC
>probe:Drosophila_2:1636368_at:124:727; Interrogation_Position=384; Antisense; TTGGCTTTGGCGCACACATGTTTTG
>probe:Drosophila_2:1636368_at:342:691; Interrogation_Position=405; Antisense; TTTGTGGTGCCATTAGTCTACGATA
>probe:Drosophila_2:1636368_at:479:465; Interrogation_Position=491; Antisense; GTTGGGCAACGTTGTGTCCATGCTC
>probe:Drosophila_2:1636368_at:526:505; Interrogation_Position=506; Antisense; GTCCATGCTCTTTTTGGGCGTCAAC
>probe:Drosophila_2:1636368_at:220:25; Interrogation_Position=541; Antisense; ATATGTACGGCATCTTGGCTGCCAT
>probe:Drosophila_2:1636368_at:716:43; Interrogation_Position=564; Antisense; ATCGCTTTTGGTGCTCGATACGGTT
>probe:Drosophila_2:1636368_at:168:299; Interrogation_Position=590; Antisense; CGCTTTTCTCGACTACTACTGGAAG
>probe:Drosophila_2:1636368_at:110:461; Interrogation_Position=616; Antisense; GATTAGGTGCCGAATTCACCCTACT
>probe:Drosophila_2:1636368_at:534:259; Interrogation_Position=645; Antisense; CACTCCATGTTTGTCCTACTGATGA
>probe:Drosophila_2:1636368_at:62:55; Interrogation_Position=666; Antisense; ATGACGATGACCCTTTCGGCGAAAT

Paste this into a BLAST search page for me
GTCAGTTCCGGCTATGCGATCTACATATGGCTATGCAACAGCGGCCTTGAATCATGGAGATAGTACCGCTGCCCCGAGCTGTATCTGAAGTCCACCAATCTTGGCTTTGGCGCACACATGTTTTGTTTGTGGTGCCATTAGTCTACGATAGTTGGGCAACGTTGTGTCCATGCTCGTCCATGCTCTTTTTGGGCGTCAACATATGTACGGCATCTTGGCTGCCATATCGCTTTTGGTGCTCGATACGGTTCGCTTTTCTCGACTACTACTGGAAGGATTAGGTGCCGAATTCACCCTACTCACTCCATGTTTGTCCTACTGATGAATGACGATGACCCTTTCGGCGAAAT

Full Affymetrix probeset data:

Annotations for 1636368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720