Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636371_at:

>probe:Drosophila_2:1636371_at:334:287; Interrogation_Position=3037; Antisense; CGGCCAAGTGTTAAGGAGATGCTGT
>probe:Drosophila_2:1636371_at:571:367; Interrogation_Position=3064; Antisense; GAAGTGTAATTTTCTTAAGCCAAAT
>probe:Drosophila_2:1636371_at:359:257; Interrogation_Position=3084; Antisense; CAAATCGAAACACCGCCGCTAATCG
>probe:Drosophila_2:1636371_at:426:187; Interrogation_Position=3092; Antisense; AACACCGCCGCTAATCGACTAAAGA
>probe:Drosophila_2:1636371_at:246:237; Interrogation_Position=3104; Antisense; AATCGACTAAAGACGTACATATATA
>probe:Drosophila_2:1636371_at:497:271; Interrogation_Position=3134; Antisense; CATAACGCTAGGATGATGTTCAATC
>probe:Drosophila_2:1636371_at:50:443; Interrogation_Position=3148; Antisense; GATGTTCAATCCAGATATCAGATTA
>probe:Drosophila_2:1636371_at:665:647; Interrogation_Position=3176; Antisense; TACAATTTTGTATGTCCTTTAAAAG
>probe:Drosophila_2:1636371_at:74:171; Interrogation_Position=3197; Antisense; AAAGGATGACTGTATGCACATAACA
>probe:Drosophila_2:1636371_at:84:661; Interrogation_Position=3217; Antisense; TAACATATGTACTACTGCCTTGCAA
>probe:Drosophila_2:1636371_at:30:669; Interrogation_Position=3229; Antisense; TACTGCCTTGCAAATTTTTTGTCTA
>probe:Drosophila_2:1636371_at:293:565; Interrogation_Position=3269; Antisense; GGCAAGCAAGTGAAGTTATTCAGAT
>probe:Drosophila_2:1636371_at:691:615; Interrogation_Position=3303; Antisense; TGCAATTTTGCATGTTCTTCATATT
>probe:Drosophila_2:1636371_at:30:349; Interrogation_Position=3312; Antisense; GCATGTTCTTCATATTATTCGTATA

Paste this into a BLAST search page for me
CGGCCAAGTGTTAAGGAGATGCTGTGAAGTGTAATTTTCTTAAGCCAAATCAAATCGAAACACCGCCGCTAATCGAACACCGCCGCTAATCGACTAAAGAAATCGACTAAAGACGTACATATATACATAACGCTAGGATGATGTTCAATCGATGTTCAATCCAGATATCAGATTATACAATTTTGTATGTCCTTTAAAAGAAAGGATGACTGTATGCACATAACATAACATATGTACTACTGCCTTGCAATACTGCCTTGCAAATTTTTTGTCTAGGCAAGCAAGTGAAGTTATTCAGATTGCAATTTTGCATGTTCTTCATATTGCATGTTCTTCATATTATTCGTATA

Full Affymetrix probeset data:

Annotations for 1636371_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime