FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636372_at:

>probe:Drosophila_2:1636372_at:335:33; Interrogation_Position=1058; Antisense; ATAATGCCGAGTGCTACATGCTCCT
>probe:Drosophila_2:1636372_at:32:621; Interrogation_Position=1076; Antisense; TGCTCCTGGGCCTTTGTTTGCGAAA
>probe:Drosophila_2:1636372_at:384:679; Interrogation_Position=1110; Antisense; TATGGAGAACGCATTCGTGGCCCTC
>probe:Drosophila_2:1636372_at:352:407; Interrogation_Position=1175; Antisense; GACGTAATCCCTTGGTTGTGCTGAA
>probe:Drosophila_2:1636372_at:136:385; Interrogation_Position=1197; Antisense; GAACTTTGCACTGTTTTGCTACGAA
>probe:Drosophila_2:1636372_at:620:581; Interrogation_Position=1232; Antisense; TGGCCCTGTCCACGGAGCAGTATAA
>probe:Drosophila_2:1636372_at:725:659; Interrogation_Position=1254; Antisense; TAACCGGTTCATGAGTCAGGCGCAG
>probe:Drosophila_2:1636372_at:144:349; Interrogation_Position=1275; Antisense; GCAGGATCTTCTGTTGCCAACGGAA
>probe:Drosophila_2:1636372_at:153:337; Interrogation_Position=1332; Antisense; GCTGCGCATCTCGAATCAGGGCAAT
>probe:Drosophila_2:1636372_at:43:19; Interrogation_Position=1394; Antisense; ATTTGGGACACAATCGGGCCACGGA
>probe:Drosophila_2:1636372_at:729:625; Interrogation_Position=1424; Antisense; TGCCGGACGAATTGCCACTGGAGGT
>probe:Drosophila_2:1636372_at:680:373; Interrogation_Position=903; Antisense; GAAGTTCATTGTGGCCATTTCATCG
>probe:Drosophila_2:1636372_at:466:583; Interrogation_Position=943; Antisense; TGGCTATCGCCACTTAACTACAATG
>probe:Drosophila_2:1636372_at:211:665; Interrogation_Position=961; Antisense; TACAATGCCCTTTACAACCTCAGTT

Paste this into a BLAST search page for me
ATAATGCCGAGTGCTACATGCTCCTTGCTCCTGGGCCTTTGTTTGCGAAATATGGAGAACGCATTCGTGGCCCTCGACGTAATCCCTTGGTTGTGCTGAAGAACTTTGCACTGTTTTGCTACGAATGGCCCTGTCCACGGAGCAGTATAATAACCGGTTCATGAGTCAGGCGCAGGCAGGATCTTCTGTTGCCAACGGAAGCTGCGCATCTCGAATCAGGGCAATATTTGGGACACAATCGGGCCACGGATGCCGGACGAATTGCCACTGGAGGTGAAGTTCATTGTGGCCATTTCATCGTGGCTATCGCCACTTAACTACAATGTACAATGCCCTTTACAACCTCAGTT

Full Affymetrix probeset data:

Annotations for 1636372_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720