Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636373_at:

>probe:Drosophila_2:1636373_at:429:23; Interrogation_Position=1556; Antisense; ATATCATGGTCTTATCCGCCGTTTG
>probe:Drosophila_2:1636373_at:282:597; Interrogation_Position=1579; Antisense; TGTGCTGCCATTGCAACAATTGCCC
>probe:Drosophila_2:1636373_at:145:245; Interrogation_Position=1614; Antisense; CAATCTAGCCATCTTAACCGATCTG
>probe:Drosophila_2:1636373_at:451:89; Interrogation_Position=1641; Antisense; AGTCATCTACAAGCTAGCCGATCTC
>probe:Drosophila_2:1636373_at:449:409; Interrogation_Position=1678; Antisense; GACGACCTCCTTCGAATGAACTTGG
>probe:Drosophila_2:1636373_at:482:317; Interrogation_Position=1717; Antisense; GCCTGTGCCTGCTTCGGTAATAATA
>probe:Drosophila_2:1636373_at:167:383; Interrogation_Position=1747; Antisense; GAACTGGGACGTCTGCGTACTGTCA
>probe:Drosophila_2:1636373_at:558:377; Interrogation_Position=1839; Antisense; GAAGCTATCGATGGATCCGCAGAAC
>probe:Drosophila_2:1636373_at:126:129; Interrogation_Position=1877; Antisense; ACCAGAGTGGAGTTGTTCCTTTCCT
>probe:Drosophila_2:1636373_at:522:305; Interrogation_Position=1894; Antisense; CCTTTCCTGCTGGAGTGCATTGGAT
>probe:Drosophila_2:1636373_at:407:545; Interrogation_Position=1915; Antisense; GGATCCACTAACAAGGAGCTCCAGT
>probe:Drosophila_2:1636373_at:537:589; Interrogation_Position=1950; Antisense; TGGTTGTCTGCGCAATATCCGCGAA
>probe:Drosophila_2:1636373_at:439:329; Interrogation_Position=1983; Antisense; GCGTGCCGAGGAATATCTGCTTAAA
>probe:Drosophila_2:1636373_at:600:235; Interrogation_Position=2007; Antisense; AATCGACGATGACTAGCTTCCTGTT

Paste this into a BLAST search page for me
ATATCATGGTCTTATCCGCCGTTTGTGTGCTGCCATTGCAACAATTGCCCCAATCTAGCCATCTTAACCGATCTGAGTCATCTACAAGCTAGCCGATCTCGACGACCTCCTTCGAATGAACTTGGGCCTGTGCCTGCTTCGGTAATAATAGAACTGGGACGTCTGCGTACTGTCAGAAGCTATCGATGGATCCGCAGAACACCAGAGTGGAGTTGTTCCTTTCCTCCTTTCCTGCTGGAGTGCATTGGATGGATCCACTAACAAGGAGCTCCAGTTGGTTGTCTGCGCAATATCCGCGAAGCGTGCCGAGGAATATCTGCTTAAAAATCGACGATGACTAGCTTCCTGTT

Full Affymetrix probeset data:

Annotations for 1636373_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime