FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636374_at:

>probe:Drosophila_2:1636374_at:378:77; Interrogation_Position=1027; Antisense; AGGAGTGCCCCTGCAACGAGTTCAA
>probe:Drosophila_2:1636374_at:108:485; Interrogation_Position=1181; Antisense; GTATGATTAGCTTTTCGCACCCACA
>probe:Drosophila_2:1636374_at:356:627; Interrogation_Position=1243; Antisense; TCCATTGTTCAATTCTCGTCTTTAG
>probe:Drosophila_2:1636374_at:300:93; Interrogation_Position=1266; Antisense; AGTTCGTACGCCCAGCAAGAGCATA
>probe:Drosophila_2:1636374_at:703:419; Interrogation_Position=1284; Antisense; GAGCATACCTCCTATATGTGCATCC
>probe:Drosophila_2:1636374_at:40:305; Interrogation_Position=1307; Antisense; CCGTATCCGTATTCGCATCAGTGGA
>probe:Drosophila_2:1636374_at:494:547; Interrogation_Position=1329; Antisense; GGATGCTTAGCTGTAACCTTAATTG
>probe:Drosophila_2:1636374_at:269:317; Interrogation_Position=1363; Antisense; GCCTGTTCGTTTGTTTGTCTGTTAA
>probe:Drosophila_2:1636374_at:231:443; Interrogation_Position=879; Antisense; GATGTGCACACCTATTGGACCTATG
>probe:Drosophila_2:1636374_at:634:1; Interrogation_Position=892; Antisense; ATTGGACCTATGAGGGTTCCCTGAC
>probe:Drosophila_2:1636374_at:637:335; Interrogation_Position=928; Antisense; GCTCGGAGTCGGTCATCTGGATCGT
>probe:Drosophila_2:1636374_at:266:641; Interrogation_Position=943; Antisense; TCTGGATCGTGTTCAAGACGCCCAT
>probe:Drosophila_2:1636374_at:365:373; Interrogation_Position=969; Antisense; GAAGTGTCCGACGACCAGCTGAACG
>probe:Drosophila_2:1636374_at:104:51; Interrogation_Position=996; Antisense; ATGCGCAATCTCAATGCCTACGACG

Paste this into a BLAST search page for me
AGGAGTGCCCCTGCAACGAGTTCAAGTATGATTAGCTTTTCGCACCCACATCCATTGTTCAATTCTCGTCTTTAGAGTTCGTACGCCCAGCAAGAGCATAGAGCATACCTCCTATATGTGCATCCCCGTATCCGTATTCGCATCAGTGGAGGATGCTTAGCTGTAACCTTAATTGGCCTGTTCGTTTGTTTGTCTGTTAAGATGTGCACACCTATTGGACCTATGATTGGACCTATGAGGGTTCCCTGACGCTCGGAGTCGGTCATCTGGATCGTTCTGGATCGTGTTCAAGACGCCCATGAAGTGTCCGACGACCAGCTGAACGATGCGCAATCTCAATGCCTACGACG

Full Affymetrix probeset data:

Annotations for 1636374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720