FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636376_at:

>probe:Drosophila_2:1636376_at:589:79; Interrogation_Position=248; Antisense; AGGTCTCGGATGTCTGTCTGCTGAA
>probe:Drosophila_2:1636376_at:128:499; Interrogation_Position=263; Antisense; GTCTGCTGAATGACCACTTCATCTT
>probe:Drosophila_2:1636376_at:204:87; Interrogation_Position=329; Antisense; AGTCCAAGATTTCGCGTTGCTTCAA
>probe:Drosophila_2:1636376_at:149:45; Interrogation_Position=354; Antisense; ATGTAACCGTGGCAGTCGAGTTTCC
>probe:Drosophila_2:1636376_at:416:547; Interrogation_Position=396; Antisense; GGATGAGAACTCTTCTACGCCGCAA
>probe:Drosophila_2:1636376_at:272:305; Interrogation_Position=429; Antisense; CCTGCAACTCTGGTCGACACGAAAT
>probe:Drosophila_2:1636376_at:508:393; Interrogation_Position=466; Antisense; GAAATCTTCGATTCCAGTACCAGGT
>probe:Drosophila_2:1636376_at:126:193; Interrogation_Position=492; Antisense; AACTAATACCAATACGCCAGGCCGG
>probe:Drosophila_2:1636376_at:727:257; Interrogation_Position=521; Antisense; CACAGCCAGCTTCCGTGATAGTTGA
>probe:Drosophila_2:1636376_at:164:511; Interrogation_Position=535; Antisense; GTGATAGTTGAGCAGCCGCATCCTA
>probe:Drosophila_2:1636376_at:220:219; Interrogation_Position=685; Antisense; AAGTCACAGCAGGTTGCCGTTCATA
>probe:Drosophila_2:1636376_at:424:487; Interrogation_Position=721; Antisense; GTACGTTGGAGCAAACCGCCGGATA
>probe:Drosophila_2:1636376_at:222:147; Interrogation_Position=747; Antisense; ACTATGGCATGGATTCGGCGTGGAC
>probe:Drosophila_2:1636376_at:99:217; Interrogation_Position=787; Antisense; AAGTCAGAACTTCGTCGTTGCCGGT

Paste this into a BLAST search page for me
AGGTCTCGGATGTCTGTCTGCTGAAGTCTGCTGAATGACCACTTCATCTTAGTCCAAGATTTCGCGTTGCTTCAAATGTAACCGTGGCAGTCGAGTTTCCGGATGAGAACTCTTCTACGCCGCAACCTGCAACTCTGGTCGACACGAAATGAAATCTTCGATTCCAGTACCAGGTAACTAATACCAATACGCCAGGCCGGCACAGCCAGCTTCCGTGATAGTTGAGTGATAGTTGAGCAGCCGCATCCTAAAGTCACAGCAGGTTGCCGTTCATAGTACGTTGGAGCAAACCGCCGGATAACTATGGCATGGATTCGGCGTGGACAAGTCAGAACTTCGTCGTTGCCGGT

Full Affymetrix probeset data:

Annotations for 1636376_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720