Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636379_a_at:

>probe:Drosophila_2:1636379_a_at:62:231; Interrogation_Position=223; Antisense; AATGATTGCAGCACCCGTGAAGTCC
>probe:Drosophila_2:1636379_a_at:72:615; Interrogation_Position=240; Antisense; TGAAGTCCGTAATGCCTTTGTCCAG
>probe:Drosophila_2:1636379_a_at:152:727; Interrogation_Position=257; Antisense; TTGTCCAGCTCTCCAAATTGTACCA
>probe:Drosophila_2:1636379_a_at:310:485; Interrogation_Position=276; Antisense; GTACCACCCAGATGTTAAGAGCAAT
>probe:Drosophila_2:1636379_a_at:499:213; Interrogation_Position=292; Antisense; AAGAGCAATGCTGCGTGTCCGGAGC
>probe:Drosophila_2:1636379_a_at:441:459; Interrogation_Position=326; Antisense; GATTTGTTCAGATCTCCGAGGCGTA
>probe:Drosophila_2:1636379_a_at:433:211; Interrogation_Position=352; Antisense; AAGACCCTGATAAAGCCGGAGCGGA
>probe:Drosophila_2:1636379_a_at:436:101; Interrogation_Position=379; Antisense; AGAGACTACGATGACAGCCTGCTGT
>probe:Drosophila_2:1636379_a_at:240:45; Interrogation_Position=485; Antisense; ATCCCAATCCAGGACCGTACTATGG
>probe:Drosophila_2:1636379_a_at:218:487; Interrogation_Position=501; Antisense; GTACTATGGCATCCGTGGTCTGAAG
>probe:Drosophila_2:1636379_a_at:145:499; Interrogation_Position=518; Antisense; GTCTGAAGAGGGTCTCCAACTGGCA
>probe:Drosophila_2:1636379_a_at:277:537; Interrogation_Position=605; Antisense; GGTCGTCCTTTAAACTGAGTCGCCA
>probe:Drosophila_2:1636379_a_at:50:609; Interrogation_Position=620; Antisense; TGAGTCGCCAGATCCAGGACGAAAT
>probe:Drosophila_2:1636379_a_at:646:649; Interrogation_Position=646; Antisense; TCAGCAGAGGCTAATTCCCATCATG

Paste this into a BLAST search page for me
AATGATTGCAGCACCCGTGAAGTCCTGAAGTCCGTAATGCCTTTGTCCAGTTGTCCAGCTCTCCAAATTGTACCAGTACCACCCAGATGTTAAGAGCAATAAGAGCAATGCTGCGTGTCCGGAGCGATTTGTTCAGATCTCCGAGGCGTAAAGACCCTGATAAAGCCGGAGCGGAAGAGACTACGATGACAGCCTGCTGTATCCCAATCCAGGACCGTACTATGGGTACTATGGCATCCGTGGTCTGAAGGTCTGAAGAGGGTCTCCAACTGGCAGGTCGTCCTTTAAACTGAGTCGCCATGAGTCGCCAGATCCAGGACGAAATTCAGCAGAGGCTAATTCCCATCATG

Full Affymetrix probeset data:

Annotations for 1636379_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime