FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636380_at:

>probe:Drosophila_2:1636380_at:119:3; Interrogation_Position=2058; Antisense; ATTGTTGGGCCCTGTTACCTGCCGA
>probe:Drosophila_2:1636380_at:227:89; Interrogation_Position=2106; Antisense; AGTCTTGTCTCTCCGAATTCTATTC
>probe:Drosophila_2:1636380_at:671:363; Interrogation_Position=2120; Antisense; GAATTCTATTCACAAATCACGCGCT
>probe:Drosophila_2:1636380_at:2:241; Interrogation_Position=2134; Antisense; AATCACGCGCTATGTCTAGGACAAA
>probe:Drosophila_2:1636380_at:429:61; Interrogation_Position=2167; Antisense; ATGTCATCCGCATGGGAATCGGCTC
>probe:Drosophila_2:1636380_at:302:241; Interrogation_Position=2224; Antisense; AATAAAGTCCTCTAGCTTACTCCAC
>probe:Drosophila_2:1636380_at:433:117; Interrogation_Position=2237; Antisense; AGCTTACTCCACTTTGTTATGACAA
>probe:Drosophila_2:1636380_at:686:235; Interrogation_Position=2271; Antisense; AATCGAATGTTTAGCCCTTCCTTGG
>probe:Drosophila_2:1636380_at:293:627; Interrogation_Position=2289; Antisense; TCCTTGGTCCAGCATCTGTACATAT
>probe:Drosophila_2:1636380_at:165:23; Interrogation_Position=2310; Antisense; ATATAGTTTACACATTCAGCTCTTT
>probe:Drosophila_2:1636380_at:627:191; Interrogation_Position=2339; Antisense; AACTATCTTTAAGCTTACTCTACGA
>probe:Drosophila_2:1636380_at:73:457; Interrogation_Position=2362; Antisense; GATAAACTCAACTCTTACCACTTAG
>probe:Drosophila_2:1636380_at:577:25; Interrogation_Position=2396; Antisense; ATAGTTCAGCTTGCACAGTTCTCCT
>probe:Drosophila_2:1636380_at:500:93; Interrogation_Position=2412; Antisense; AGTTCTCCTTGTAATCCATCAACAC

Paste this into a BLAST search page for me
ATTGTTGGGCCCTGTTACCTGCCGAAGTCTTGTCTCTCCGAATTCTATTCGAATTCTATTCACAAATCACGCGCTAATCACGCGCTATGTCTAGGACAAAATGTCATCCGCATGGGAATCGGCTCAATAAAGTCCTCTAGCTTACTCCACAGCTTACTCCACTTTGTTATGACAAAATCGAATGTTTAGCCCTTCCTTGGTCCTTGGTCCAGCATCTGTACATATATATAGTTTACACATTCAGCTCTTTAACTATCTTTAAGCTTACTCTACGAGATAAACTCAACTCTTACCACTTAGATAGTTCAGCTTGCACAGTTCTCCTAGTTCTCCTTGTAATCCATCAACAC

Full Affymetrix probeset data:

Annotations for 1636380_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720