Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636382_at:

>probe:Drosophila_2:1636382_at:306:273; Interrogation_Position=1103; Antisense; CATTTGTTTCGATGTGCACTTTCAC
>probe:Drosophila_2:1636382_at:612:233; Interrogation_Position=615; Antisense; AATGCCTATGCCGATGCCGGGTCAG
>probe:Drosophila_2:1636382_at:255:623; Interrogation_Position=629; Antisense; TGCCGGGTCAGCAAACGCATGGCGT
>probe:Drosophila_2:1636382_at:632:347; Interrogation_Position=645; Antisense; GCATGGCGTGGCGTATCCGACGTAT
>probe:Drosophila_2:1636382_at:582:611; Interrogation_Position=708; Antisense; TGACATGTCCATGGCTAATCCAGGA
>probe:Drosophila_2:1636382_at:392:235; Interrogation_Position=724; Antisense; AATCCAGGACCTAGTGTTATGCCCG
>probe:Drosophila_2:1636382_at:89:515; Interrogation_Position=737; Antisense; GTGTTATGCCCGCTGGATATGAGAA
>probe:Drosophila_2:1636382_at:435:55; Interrogation_Position=755; Antisense; ATGAGAAGCAAGCTCCCTACAATCC
>probe:Drosophila_2:1636382_at:336:665; Interrogation_Position=772; Antisense; TACAATCCCCACTTTGGCCAGTGAA
>probe:Drosophila_2:1636382_at:482:355; Interrogation_Position=800; Antisense; GCACTGTGAACTGAGGATCCCCTTT
>probe:Drosophila_2:1636382_at:574:147; Interrogation_Position=858; Antisense; ACTTTACTTTCCATGTTTTCTTGCA
>probe:Drosophila_2:1636382_at:248:393; Interrogation_Position=917; Antisense; GAAAGCGATCGCACAACGAGCCATT
>probe:Drosophila_2:1636382_at:543:137; Interrogation_Position=932; Antisense; ACGAGCCATTTTTATATTCCATGTG
>probe:Drosophila_2:1636382_at:205:205; Interrogation_Position=983; Antisense; AAGCGCAACCTTCTATTTATACATC

Paste this into a BLAST search page for me
CATTTGTTTCGATGTGCACTTTCACAATGCCTATGCCGATGCCGGGTCAGTGCCGGGTCAGCAAACGCATGGCGTGCATGGCGTGGCGTATCCGACGTATTGACATGTCCATGGCTAATCCAGGAAATCCAGGACCTAGTGTTATGCCCGGTGTTATGCCCGCTGGATATGAGAAATGAGAAGCAAGCTCCCTACAATCCTACAATCCCCACTTTGGCCAGTGAAGCACTGTGAACTGAGGATCCCCTTTACTTTACTTTCCATGTTTTCTTGCAGAAAGCGATCGCACAACGAGCCATTACGAGCCATTTTTATATTCCATGTGAAGCGCAACCTTCTATTTATACATC

Full Affymetrix probeset data:

Annotations for 1636382_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime