FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636383_at:

>probe:Drosophila_2:1636383_at:17:203; Interrogation_Position=121; Antisense; AACCGGATTGTGGTGCAGTCACCCT
>probe:Drosophila_2:1636383_at:87:651; Interrogation_Position=139; Antisense; TCACCCTCGCTGGACAACTTGTATA
>probe:Drosophila_2:1636383_at:726:139; Interrogation_Position=170; Antisense; ACGTGGTCACATCGAAGCCGCTGAA
>probe:Drosophila_2:1636383_at:528:151; Interrogation_Position=290; Antisense; ACATACCTGGCATCGGCTTGGATTA
>probe:Drosophila_2:1636383_at:336:45; Interrogation_Position=332; Antisense; ATCCCATCCTTCACGAGTCGGAGAG
>probe:Drosophila_2:1636383_at:136:347; Interrogation_Position=34; Antisense; GCATCGCTAATCATCTTGGCCAATT
>probe:Drosophila_2:1636383_at:671:423; Interrogation_Position=363; Antisense; GAGAAAGACCACAACGGTTCGCCCA
>probe:Drosophila_2:1636383_at:591:673; Interrogation_Position=405; Antisense; TAGCCCCAATCTGGATCATCGGAAT
>probe:Drosophila_2:1636383_at:292:489; Interrogation_Position=439; Antisense; GTACTTCGAGTGCAACACCTCAAGG
>probe:Drosophila_2:1636383_at:697:75; Interrogation_Position=461; Antisense; AGGATTACTACTTCAATGGGCGCCC
>probe:Drosophila_2:1636383_at:214:285; Interrogation_Position=493; Antisense; CTGCAGGTTGCCCATGCTGATAAAA
>probe:Drosophila_2:1636383_at:367:611; Interrogation_Position=527; Antisense; TGACGGCCCTTAACCTGAAGTCCAA
>probe:Drosophila_2:1636383_at:410:243; Interrogation_Position=55; Antisense; AATTTGGTGGCATCTCGACCCTATT
>probe:Drosophila_2:1636383_at:278:689; Interrogation_Position=76; Antisense; TATTCCTATGGTCCACGGGCAGAAG

Paste this into a BLAST search page for me
AACCGGATTGTGGTGCAGTCACCCTTCACCCTCGCTGGACAACTTGTATAACGTGGTCACATCGAAGCCGCTGAAACATACCTGGCATCGGCTTGGATTAATCCCATCCTTCACGAGTCGGAGAGGCATCGCTAATCATCTTGGCCAATTGAGAAAGACCACAACGGTTCGCCCATAGCCCCAATCTGGATCATCGGAATGTACTTCGAGTGCAACACCTCAAGGAGGATTACTACTTCAATGGGCGCCCCTGCAGGTTGCCCATGCTGATAAAATGACGGCCCTTAACCTGAAGTCCAAAATTTGGTGGCATCTCGACCCTATTTATTCCTATGGTCCACGGGCAGAAG

Full Affymetrix probeset data:

Annotations for 1636383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720