FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636384_at:

>probe:Drosophila_2:1636384_at:402:279; Interrogation_Position=3065; Antisense; CTACGAGATCTTTCGCCAGGAGCAA
>probe:Drosophila_2:1636384_at:158:309; Interrogation_Position=3101; Antisense; CCAGCGCCAGGTGCAAGAGTTCTTG
>probe:Drosophila_2:1636384_at:402:581; Interrogation_Position=3124; Antisense; TGGCCCGCGACGAGACCAATGAGTA
>probe:Drosophila_2:1636384_at:471:487; Interrogation_Position=3146; Antisense; GTACGATAATCTCGACCTGGACCAC
>probe:Drosophila_2:1636384_at:725:585; Interrogation_Position=3163; Antisense; TGGACCACGCCTACAGAGCTAAGTA
>probe:Drosophila_2:1636384_at:346:411; Interrogation_Position=3244; Antisense; GACGCGATTCCGGATCGGAGCATTC
>probe:Drosophila_2:1636384_at:63:523; Interrogation_Position=3273; Antisense; GGGCGGGACAACTACACCACGTATG
>probe:Drosophila_2:1636384_at:276:371; Interrogation_Position=3356; Antisense; GAATGGACTCCAGCGGGAGCACGAC
>probe:Drosophila_2:1636384_at:427:671; Interrogation_Position=3387; Antisense; TACGGGTTGTTTTGGCTGAATGATC
>probe:Drosophila_2:1636384_at:511:163; Interrogation_Position=3426; Antisense; AAATATCGCCGCAAGTTGGCACAGA
>probe:Drosophila_2:1636384_at:695:51; Interrogation_Position=3520; Antisense; ATGCTCCCTACGATCACATGAGGCC
>probe:Drosophila_2:1636384_at:569:439; Interrogation_Position=3539; Antisense; GAGGCCCACGGAGGACGACATTCAG
>probe:Drosophila_2:1636384_at:506:403; Interrogation_Position=3570; Antisense; GACTCCTTGCCGGAGAGCAACTGAT
>probe:Drosophila_2:1636384_at:76:63; Interrogation_Position=3595; Antisense; ATGTCCTAGAATATTTGTCCCAATC

Paste this into a BLAST search page for me
CTACGAGATCTTTCGCCAGGAGCAACCAGCGCCAGGTGCAAGAGTTCTTGTGGCCCGCGACGAGACCAATGAGTAGTACGATAATCTCGACCTGGACCACTGGACCACGCCTACAGAGCTAAGTAGACGCGATTCCGGATCGGAGCATTCGGGCGGGACAACTACACCACGTATGGAATGGACTCCAGCGGGAGCACGACTACGGGTTGTTTTGGCTGAATGATCAAATATCGCCGCAAGTTGGCACAGAATGCTCCCTACGATCACATGAGGCCGAGGCCCACGGAGGACGACATTCAGGACTCCTTGCCGGAGAGCAACTGATATGTCCTAGAATATTTGTCCCAATC

Full Affymetrix probeset data:

Annotations for 1636384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720