Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636385_at:

>probe:Drosophila_2:1636385_at:436:543; Interrogation_Position=1214; Antisense; GGATTTGAATCAACCCAGCCGAAAA
>probe:Drosophila_2:1636385_at:610:123; Interrogation_Position=1230; Antisense; AGCCGAAAAGTAGCCAGCCGTCCAT
>probe:Drosophila_2:1636385_at:460:503; Interrogation_Position=1249; Antisense; GTCCATTCCCATTAATGCTGGGCGG
>probe:Drosophila_2:1636385_at:369:233; Interrogation_Position=1262; Antisense; AATGCTGGGCGGAATATCCTGCGGC
>probe:Drosophila_2:1636385_at:324:631; Interrogation_Position=1278; Antisense; TCCTGCGGCGCCAAGTGAAAGGGAT
>probe:Drosophila_2:1636385_at:127:149; Interrogation_Position=1305; Antisense; ACTTGGGAGGACATCCAACTTGGAA
>probe:Drosophila_2:1636385_at:411:363; Interrogation_Position=1327; Antisense; GAATTGGGCGCTCATCTTTTGATGA
>probe:Drosophila_2:1636385_at:92:413; Interrogation_Position=1370; Antisense; GACCGCTTGTCACCCTAATGAAAAT
>probe:Drosophila_2:1636385_at:347:199; Interrogation_Position=1417; Antisense; AACGCAAAGCCGCAAGCCAAACAAT
>probe:Drosophila_2:1636385_at:54:143; Interrogation_Position=1446; Antisense; ACTGTTGGCCAGGACCCAATAGCAA
>probe:Drosophila_2:1636385_at:161:275; Interrogation_Position=1536; Antisense; CTTGTGGACTGTGTGTTGTCTGTAC
>probe:Drosophila_2:1636385_at:130:473; Interrogation_Position=1568; Antisense; GTTCAACTACAAGAGACCCCGCTGG
>probe:Drosophila_2:1636385_at:111:403; Interrogation_Position=1656; Antisense; GAGCTAGTCGAATACGAAACTCCAT
>probe:Drosophila_2:1636385_at:304:189; Interrogation_Position=1703; Antisense; AACATATGTGTAAGCCCCAGGACAA

Paste this into a BLAST search page for me
GGATTTGAATCAACCCAGCCGAAAAAGCCGAAAAGTAGCCAGCCGTCCATGTCCATTCCCATTAATGCTGGGCGGAATGCTGGGCGGAATATCCTGCGGCTCCTGCGGCGCCAAGTGAAAGGGATACTTGGGAGGACATCCAACTTGGAAGAATTGGGCGCTCATCTTTTGATGAGACCGCTTGTCACCCTAATGAAAATAACGCAAAGCCGCAAGCCAAACAATACTGTTGGCCAGGACCCAATAGCAACTTGTGGACTGTGTGTTGTCTGTACGTTCAACTACAAGAGACCCCGCTGGGAGCTAGTCGAATACGAAACTCCATAACATATGTGTAAGCCCCAGGACAA

Full Affymetrix probeset data:

Annotations for 1636385_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime