FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636387_at:

>probe:Drosophila_2:1636387_at:243:245; Interrogation_Position=1040; Antisense; AATTTAAGGCCTATTCGGGTCACTG
>probe:Drosophila_2:1636387_at:340:277; Interrogation_Position=1050; Antisense; CTATTCGGGTCACTGGGTATCTCGT
>probe:Drosophila_2:1636387_at:675:537; Interrogation_Position=1065; Antisense; GGTATCTCGTGTATCCTCTTAAAAA
>probe:Drosophila_2:1636387_at:497:25; Interrogation_Position=1089; Antisense; ATAGCTTTACAATTGCCTAAGGTGC
>probe:Drosophila_2:1636387_at:373:657; Interrogation_Position=1128; Antisense; TAAGTGCTGCACTTCCGTTTGAAGT
>probe:Drosophila_2:1636387_at:694:573; Interrogation_Position=1218; Antisense; GGCGTGGCCTTATTTTGAATGGGAC
>probe:Drosophila_2:1636387_at:303:229; Interrogation_Position=1235; Antisense; AATGGGACTCGTGGTGCTCTTATTG
>probe:Drosophila_2:1636387_at:495:535; Interrogation_Position=1247; Antisense; GGTGCTCTTATTGATGCTCTGAACA
>probe:Drosophila_2:1636387_at:75:87; Interrogation_Position=1285; Antisense; AGTCCAAACTGGAGCCATTGGCATT
>probe:Drosophila_2:1636387_at:16:571; Interrogation_Position=1304; Antisense; GGCATTGCCATCAAAGTCTATACAA
>probe:Drosophila_2:1636387_at:627:205; Interrogation_Position=1437; Antisense; AAGCGCCAGCATAGGAGCTCTGCAA
>probe:Drosophila_2:1636387_at:150:195; Interrogation_Position=931; Antisense; AACTGGACGGGATGAGCGGTTCCTT
>probe:Drosophila_2:1636387_at:549:539; Interrogation_Position=948; Antisense; GGTTCCTTCCGCAAATTGGAGCTAG
>probe:Drosophila_2:1636387_at:561:409; Interrogation_Position=982; Antisense; GACGACTCTAGTTGCTGTTTTGAAT

Paste this into a BLAST search page for me
AATTTAAGGCCTATTCGGGTCACTGCTATTCGGGTCACTGGGTATCTCGTGGTATCTCGTGTATCCTCTTAAAAAATAGCTTTACAATTGCCTAAGGTGCTAAGTGCTGCACTTCCGTTTGAAGTGGCGTGGCCTTATTTTGAATGGGACAATGGGACTCGTGGTGCTCTTATTGGGTGCTCTTATTGATGCTCTGAACAAGTCCAAACTGGAGCCATTGGCATTGGCATTGCCATCAAAGTCTATACAAAAGCGCCAGCATAGGAGCTCTGCAAAACTGGACGGGATGAGCGGTTCCTTGGTTCCTTCCGCAAATTGGAGCTAGGACGACTCTAGTTGCTGTTTTGAAT

Full Affymetrix probeset data:

Annotations for 1636387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720