Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636388_at:

>probe:Drosophila_2:1636388_at:224:99; Interrogation_Position=1023; Antisense; AGATGAGCAAGTTCGCGGCCACCAT
>probe:Drosophila_2:1636388_at:426:511; Interrogation_Position=1076; Antisense; GTGAAGCGCACCAACGAGACCAAGG
>probe:Drosophila_2:1636388_at:321:659; Interrogation_Position=1102; Antisense; TAAGATCAACATGTCCCATCTGGCC
>probe:Drosophila_2:1636388_at:253:579; Interrogation_Position=1123; Antisense; GGCCAAGGGCAAGATCTCGATAAAG
>probe:Drosophila_2:1636388_at:679:453; Interrogation_Position=1141; Antisense; GATAAAGCGCCGATAGCTCCGCCGT
>probe:Drosophila_2:1636388_at:544:465; Interrogation_Position=1198; Antisense; GTTTCCTCGGTCAAGAGACGTACTT
>probe:Drosophila_2:1636388_at:173:621; Interrogation_Position=768; Antisense; TGCTCGTCTACCAGCTGGATGATAA
>probe:Drosophila_2:1636388_at:256:413; Interrogation_Position=806; Antisense; GACCTAAAGATCATCCAGCGTGGCA
>probe:Drosophila_2:1636388_at:390:261; Interrogation_Position=821; Antisense; CAGCGTGGCAGACCGAATCCAGTTC
>probe:Drosophila_2:1636388_at:375:195; Interrogation_Position=854; Antisense; AACGGCAGCGGCTCCTACGGCAGTG
>probe:Drosophila_2:1636388_at:570:111; Interrogation_Position=891; Antisense; AGCAATCGATGCACGTTCTGGCCGA
>probe:Drosophila_2:1636388_at:461:311; Interrogation_Position=924; Antisense; CCAATAGCGGCCTGGTGGAGACTCG
>probe:Drosophila_2:1636388_at:3:43; Interrogation_Position=950; Antisense; ATCGAGGACAACAAGCTGCTGTACG
>probe:Drosophila_2:1636388_at:431:303; Interrogation_Position=991; Antisense; CCGCGGCCAGCAGGTCTATGTCGAG

Paste this into a BLAST search page for me
AGATGAGCAAGTTCGCGGCCACCATGTGAAGCGCACCAACGAGACCAAGGTAAGATCAACATGTCCCATCTGGCCGGCCAAGGGCAAGATCTCGATAAAGGATAAAGCGCCGATAGCTCCGCCGTGTTTCCTCGGTCAAGAGACGTACTTTGCTCGTCTACCAGCTGGATGATAAGACCTAAAGATCATCCAGCGTGGCACAGCGTGGCAGACCGAATCCAGTTCAACGGCAGCGGCTCCTACGGCAGTGAGCAATCGATGCACGTTCTGGCCGACCAATAGCGGCCTGGTGGAGACTCGATCGAGGACAACAAGCTGCTGTACGCCGCGGCCAGCAGGTCTATGTCGAG

Full Affymetrix probeset data:

Annotations for 1636388_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime