Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636390_at:

>probe:Drosophila_2:1636390_at:369:469; Interrogation_Position=102; Antisense; GTTGCAGAGCCTACCAGATTCCGGG
>probe:Drosophila_2:1636390_at:374:349; Interrogation_Position=143; Antisense; GCAGTTTGCCCGTCAGGAGCAGGCT
>probe:Drosophila_2:1636390_at:429:703; Interrogation_Position=233; Antisense; TTATCCGCCAGCAGGAGTGACACCG
>probe:Drosophila_2:1636390_at:230:413; Interrogation_Position=247; Antisense; GAGTGACACCGGAGGTGCCCTTCGA
>probe:Drosophila_2:1636390_at:704:715; Interrogation_Position=267; Antisense; TTCGACCTGCCCACGGAGACTGAAG
>probe:Drosophila_2:1636390_at:223:425; Interrogation_Position=282; Antisense; GAGACTGAAGCGCAACCTGATCTTA
>probe:Drosophila_2:1636390_at:514:661; Interrogation_Position=353; Antisense; TAACACTTACGGACCACCTGCTGAG
>probe:Drosophila_2:1636390_at:643:557; Interrogation_Position=380; Antisense; GGAAAACACCTATGGACCGCCGGCT
>probe:Drosophila_2:1636390_at:403:343; Interrogation_Position=451; Antisense; GCTTGATCCAGCCTCGTAACGAACG
>probe:Drosophila_2:1636390_at:132:109; Interrogation_Position=502; Antisense; AGAAGCTTCGATCCGCTCAGATTAT
>probe:Drosophila_2:1636390_at:512:649; Interrogation_Position=518; Antisense; TCAGATTATCCGCTCTGGATCAGTT
>probe:Drosophila_2:1636390_at:394:285; Interrogation_Position=532; Antisense; CTGGATCAGTTCTGGTGTACACCAT
>probe:Drosophila_2:1636390_at:414:61; Interrogation_Position=562; Antisense; ATGGGTCAACCCTAATTTGCTAGAA
>probe:Drosophila_2:1636390_at:632:457; Interrogation_Position=610; Antisense; GATATGCATTTATTACTTTGTCGCT

Paste this into a BLAST search page for me
GTTGCAGAGCCTACCAGATTCCGGGGCAGTTTGCCCGTCAGGAGCAGGCTTTATCCGCCAGCAGGAGTGACACCGGAGTGACACCGGAGGTGCCCTTCGATTCGACCTGCCCACGGAGACTGAAGGAGACTGAAGCGCAACCTGATCTTATAACACTTACGGACCACCTGCTGAGGGAAAACACCTATGGACCGCCGGCTGCTTGATCCAGCCTCGTAACGAACGAGAAGCTTCGATCCGCTCAGATTATTCAGATTATCCGCTCTGGATCAGTTCTGGATCAGTTCTGGTGTACACCATATGGGTCAACCCTAATTTGCTAGAAGATATGCATTTATTACTTTGTCGCT

Full Affymetrix probeset data:

Annotations for 1636390_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime