FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636391_at:

>probe:Drosophila_2:1636391_at:52:429; Interrogation_Position=3287; Antisense; GAGATTATACTTACACACACTCAAT
>probe:Drosophila_2:1636391_at:687:191; Interrogation_Position=3338; Antisense; AACTATGTTCAGAGACACGCGATAA
>probe:Drosophila_2:1636391_at:646:589; Interrogation_Position=3370; Antisense; TGGTTTTTGTGGTTCGGTGTCGCTT
>probe:Drosophila_2:1636391_at:108:517; Interrogation_Position=3386; Antisense; GTGTCGCTTCTTATGCAATCGTTAT
>probe:Drosophila_2:1636391_at:170:397; Interrogation_Position=3418; Antisense; GACAACAAATACTTGGACCACTTGG
>probe:Drosophila_2:1636391_at:665:565; Interrogation_Position=3561; Antisense; GGCACACGTTTATACACCTATTTAC
>probe:Drosophila_2:1636391_at:65:539; Interrogation_Position=3623; Antisense; GGTAACTTTGTTTCATGTTTCGTTG
>probe:Drosophila_2:1636391_at:79:689; Interrogation_Position=3640; Antisense; TTTCGTTGTTGTGCCATCTGAACCA
>probe:Drosophila_2:1636391_at:271:39; Interrogation_Position=3655; Antisense; ATCTGAACCACTCCTAACTTATGTA
>probe:Drosophila_2:1636391_at:405:59; Interrogation_Position=3675; Antisense; ATGTAAATCCTGAACGCAATAGCGA
>probe:Drosophila_2:1636391_at:386:603; Interrogation_Position=3715; Antisense; TGAGGAGGCAATTTTACGTTAGTTT
>probe:Drosophila_2:1636391_at:6:477; Interrogation_Position=3736; Antisense; GTTTTACTTTAGCATTTATCCCACA
>probe:Drosophila_2:1636391_at:561:703; Interrogation_Position=3751; Antisense; TTATCCCACATAACTAGAAACGCTT
>probe:Drosophila_2:1636391_at:510:389; Interrogation_Position=3767; Antisense; GAAACGCTTCATCCAAAAATACACG

Paste this into a BLAST search page for me
GAGATTATACTTACACACACTCAATAACTATGTTCAGAGACACGCGATAATGGTTTTTGTGGTTCGGTGTCGCTTGTGTCGCTTCTTATGCAATCGTTATGACAACAAATACTTGGACCACTTGGGGCACACGTTTATACACCTATTTACGGTAACTTTGTTTCATGTTTCGTTGTTTCGTTGTTGTGCCATCTGAACCAATCTGAACCACTCCTAACTTATGTAATGTAAATCCTGAACGCAATAGCGATGAGGAGGCAATTTTACGTTAGTTTGTTTTACTTTAGCATTTATCCCACATTATCCCACATAACTAGAAACGCTTGAAACGCTTCATCCAAAAATACACG

Full Affymetrix probeset data:

Annotations for 1636391_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720