FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636392_at:

>probe:Drosophila_2:1636392_at:559:339; Interrogation_Position=110; Antisense; GCTATCCGCCCAATTGTCCGGAGGA
>probe:Drosophila_2:1636392_at:377:729; Interrogation_Position=123; Antisense; TTGTCCGGAGGACGCCTGCCAATGT
>probe:Drosophila_2:1636392_at:231:231; Interrogation_Position=143; Antisense; AATGTCCTCAGGAGTGCGTGGCCAT
>probe:Drosophila_2:1636392_at:529:341; Interrogation_Position=15; Antisense; GCTATTGATTTCTTTTAGTGACCAA
>probe:Drosophila_2:1636392_at:495:579; Interrogation_Position=161; Antisense; TGGCCATTGGCGAGTATGCTGGACA
>probe:Drosophila_2:1636392_at:634:77; Interrogation_Position=185; Antisense; AGGATGGTGCCGACACCTACTGCAT
>probe:Drosophila_2:1636392_at:434:261; Interrogation_Position=198; Antisense; CACCTACTGCATGGACAAGTGTCTC
>probe:Drosophila_2:1636392_at:496:397; Interrogation_Position=211; Antisense; GACAAGTGTCTCAACTATGAATCGG
>probe:Drosophila_2:1636392_at:446:677; Interrogation_Position=226; Antisense; TATGAATCGGAGTGTCCGCCGGACA
>probe:Drosophila_2:1636392_at:217:83; Interrogation_Position=236; Antisense; AGTGTCCGCCGGACAGATGCCGCTG
>probe:Drosophila_2:1636392_at:288:413; Interrogation_Position=34; Antisense; GACCAAAAGTGCATTGGCGCCCCAG
>probe:Drosophila_2:1636392_at:489:721; Interrogation_Position=70; Antisense; TTGCCGGGCATCGACAACTGGTGCG
>probe:Drosophila_2:1636392_at:63:197; Interrogation_Position=85; Antisense; AACTGGTGCGAGATCAATTGCCTGC
>probe:Drosophila_2:1636392_at:635:427; Interrogation_Position=94; Antisense; GAGATCAATTGCCTGCGCTATCCGC

Paste this into a BLAST search page for me
GCTATCCGCCCAATTGTCCGGAGGATTGTCCGGAGGACGCCTGCCAATGTAATGTCCTCAGGAGTGCGTGGCCATGCTATTGATTTCTTTTAGTGACCAATGGCCATTGGCGAGTATGCTGGACAAGGATGGTGCCGACACCTACTGCATCACCTACTGCATGGACAAGTGTCTCGACAAGTGTCTCAACTATGAATCGGTATGAATCGGAGTGTCCGCCGGACAAGTGTCCGCCGGACAGATGCCGCTGGACCAAAAGTGCATTGGCGCCCCAGTTGCCGGGCATCGACAACTGGTGCGAACTGGTGCGAGATCAATTGCCTGCGAGATCAATTGCCTGCGCTATCCGC

Full Affymetrix probeset data:

Annotations for 1636392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720