FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636393_at:

>probe:Drosophila_2:1636393_at:376:389; Interrogation_Position=2072; Antisense; GAAAACACCCACTACTGATCGCAGT
>probe:Drosophila_2:1636393_at:288:451; Interrogation_Position=2088; Antisense; GATCGCAGTAGACATCGTGGCTCTT
>probe:Drosophila_2:1636393_at:347:583; Interrogation_Position=2105; Antisense; TGGCTCTTCTCGGTATCGCACAAAG
>probe:Drosophila_2:1636393_at:647:125; Interrogation_Position=2169; Antisense; ACCAGCGTTCAAATCGATCAATCCC
>probe:Drosophila_2:1636393_at:388:33; Interrogation_Position=2185; Antisense; ATCAATCCCACTCGCAAAGCTATTA
>probe:Drosophila_2:1636393_at:287:73; Interrogation_Position=2261; Antisense; AGGACGTGGCTCGAGACCGACAAGA
>probe:Drosophila_2:1636393_at:541:473; Interrogation_Position=2290; Antisense; GTTACGTCAGAAATCACGGCCCGGT
>probe:Drosophila_2:1636393_at:368:121; Interrogation_Position=2365; Antisense; AGCGGACTACTAAGGGCGTCTTCGA
>probe:Drosophila_2:1636393_at:540:497; Interrogation_Position=2382; Antisense; GTCTTCGACACGACGCTGTTCAAGA
>probe:Drosophila_2:1636393_at:215:213; Interrogation_Position=2403; Antisense; AAGAGTCCCCTCAGCGATAGGGAGA
>probe:Drosophila_2:1636393_at:577:101; Interrogation_Position=2431; Antisense; AGAGAAATCTCCATGGGCTGCGTCA
>probe:Drosophila_2:1636393_at:95:595; Interrogation_Position=2444; Antisense; TGGGCTGCGTCAGAACTTGCCAAAA
>probe:Drosophila_2:1636393_at:113:59; Interrogation_Position=2555; Antisense; ATGTTAATACGTTTTGTCCCTAGAT
>probe:Drosophila_2:1636393_at:491:457; Interrogation_Position=2639; Antisense; GATACCACATTTTTCTACGTTACTT

Paste this into a BLAST search page for me
GAAAACACCCACTACTGATCGCAGTGATCGCAGTAGACATCGTGGCTCTTTGGCTCTTCTCGGTATCGCACAAAGACCAGCGTTCAAATCGATCAATCCCATCAATCCCACTCGCAAAGCTATTAAGGACGTGGCTCGAGACCGACAAGAGTTACGTCAGAAATCACGGCCCGGTAGCGGACTACTAAGGGCGTCTTCGAGTCTTCGACACGACGCTGTTCAAGAAAGAGTCCCCTCAGCGATAGGGAGAAGAGAAATCTCCATGGGCTGCGTCATGGGCTGCGTCAGAACTTGCCAAAAATGTTAATACGTTTTGTCCCTAGATGATACCACATTTTTCTACGTTACTT

Full Affymetrix probeset data:

Annotations for 1636393_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720