FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636395_at:

>probe:Drosophila_2:1636395_at:228:9; Interrogation_Position=2580; Antisense; ATTGCCCGTGGAAAGGTGTACCTGA
>probe:Drosophila_2:1636395_at:301:205; Interrogation_Position=2644; Antisense; AAGCCGAGAAGGAGATCCACCTGCC
>probe:Drosophila_2:1636395_at:40:385; Interrogation_Position=2810; Antisense; GAACTTCTTGGATCACACCGAGGGC
>probe:Drosophila_2:1636395_at:181:523; Interrogation_Position=2831; Antisense; GGGCCAAGTGGTTAGCTTCAACATT
>probe:Drosophila_2:1636395_at:306:147; Interrogation_Position=2872; Antisense; ACTTGAACGGTGTCGAAATTCGCGA
>probe:Drosophila_2:1636395_at:141:163; Interrogation_Position=2887; Antisense; AAATTCGCGAGACTACCTTGGACGG
>probe:Drosophila_2:1636395_at:342:129; Interrogation_Position=2901; Antisense; ACCTTGGACGGCAACTTGCCATTGA
>probe:Drosophila_2:1636395_at:406:55; Interrogation_Position=2931; Antisense; ATGAAGCGCTTCAAGTTCCACCACG
>probe:Drosophila_2:1636395_at:263:297; Interrogation_Position=2954; Antisense; CGACAGCTCGGGACAGAAGCCAGAT
>probe:Drosophila_2:1636395_at:92:127; Interrogation_Position=2971; Antisense; AGCCAGATGCTGTTGAGTACTTCAC
>probe:Drosophila_2:1636395_at:313:159; Interrogation_Position=3004; Antisense; ACAAGCCACTGGCTGCTGAGCAGTC
>probe:Drosophila_2:1636395_at:682:75; Interrogation_Position=3031; Antisense; AGGAGGCCTCCGAGTTCAGCGTCAC
>probe:Drosophila_2:1636395_at:392:351; Interrogation_Position=3068; Antisense; GCAGATCCGTACATTCATTATCAAG
>probe:Drosophila_2:1636395_at:545:663; Interrogation_Position=3099; Antisense; TAAACCAACGTTCTCAATGCAGTAT

Paste this into a BLAST search page for me
ATTGCCCGTGGAAAGGTGTACCTGAAAGCCGAGAAGGAGATCCACCTGCCGAACTTCTTGGATCACACCGAGGGCGGGCCAAGTGGTTAGCTTCAACATTACTTGAACGGTGTCGAAATTCGCGAAAATTCGCGAGACTACCTTGGACGGACCTTGGACGGCAACTTGCCATTGAATGAAGCGCTTCAAGTTCCACCACGCGACAGCTCGGGACAGAAGCCAGATAGCCAGATGCTGTTGAGTACTTCACACAAGCCACTGGCTGCTGAGCAGTCAGGAGGCCTCCGAGTTCAGCGTCACGCAGATCCGTACATTCATTATCAAGTAAACCAACGTTCTCAATGCAGTAT

Full Affymetrix probeset data:

Annotations for 1636395_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720