FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636397_at:

>probe:Drosophila_2:1636397_at:205:593; Interrogation_Position=294; Antisense; TGGTGTTCCTGCCAATCCAGTTTCA
>probe:Drosophila_2:1636397_at:613:159; Interrogation_Position=327; Antisense; ACAACCCGTGATTGTGCCTCTGAAT
>probe:Drosophila_2:1636397_at:394:165; Interrogation_Position=418; Antisense; AAATCCTATTCGCAGCAGTTGCAGA
>probe:Drosophila_2:1636397_at:481:469; Interrogation_Position=435; Antisense; GTTGCAGATGGGATGTCCAGCCACC
>probe:Drosophila_2:1636397_at:164:313; Interrogation_Position=454; Antisense; GCCACCCATCTGGTCAAGGATATGT
>probe:Drosophila_2:1636397_at:279:457; Interrogation_Position=472; Antisense; GATATGTACGGAACCTACTACTGCC
>probe:Drosophila_2:1636397_at:595:607; Interrogation_Position=561; Antisense; TGAGGCACAGAATCCGCACGGCATG
>probe:Drosophila_2:1636397_at:593:347; Interrogation_Position=581; Antisense; GCATGCTCTTCGATCTGATATCCAT
>probe:Drosophila_2:1636397_at:512:311; Interrogation_Position=610; Antisense; GCCACCATGTTTAATTACCAGCCCA
>probe:Drosophila_2:1636397_at:451:551; Interrogation_Position=741; Antisense; GGAGATAGCCCACAAGCCCAAGTAT
>probe:Drosophila_2:1636397_at:694:251; Interrogation_Position=759; Antisense; CAAGTATCGGGAGGCCTTTACTGCC
>probe:Drosophila_2:1636397_at:176:233; Interrogation_Position=800; Antisense; AATGCGCCAGTTTGTATGGACCACA
>probe:Drosophila_2:1636397_at:543:65; Interrogation_Position=815; Antisense; ATGGACCACATTGCCGGCAGAGTTT
>probe:Drosophila_2:1636397_at:475:101; Interrogation_Position=833; Antisense; AGAGTTTTTTGCTGCTCATCAGCGA

Paste this into a BLAST search page for me
TGGTGTTCCTGCCAATCCAGTTTCAACAACCCGTGATTGTGCCTCTGAATAAATCCTATTCGCAGCAGTTGCAGAGTTGCAGATGGGATGTCCAGCCACCGCCACCCATCTGGTCAAGGATATGTGATATGTACGGAACCTACTACTGCCTGAGGCACAGAATCCGCACGGCATGGCATGCTCTTCGATCTGATATCCATGCCACCATGTTTAATTACCAGCCCAGGAGATAGCCCACAAGCCCAAGTATCAAGTATCGGGAGGCCTTTACTGCCAATGCGCCAGTTTGTATGGACCACAATGGACCACATTGCCGGCAGAGTTTAGAGTTTTTTGCTGCTCATCAGCGA

Full Affymetrix probeset data:

Annotations for 1636397_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720