FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636398_at:

>probe:Drosophila_2:1636398_at:216:57; Interrogation_Position=1293; Antisense; ATGACCACTGATATTGCGGACACGG
>probe:Drosophila_2:1636398_at:4:157; Interrogation_Position=1312; Antisense; ACACGGACGCGAACACGGTCAGCGA
>probe:Drosophila_2:1636398_at:251:135; Interrogation_Position=1355; Antisense; ACGCTATCCGGTCTTCGATGTGGAC
>probe:Drosophila_2:1636398_at:423:625; Interrogation_Position=1442; Antisense; TGCCGATCCTGGACAGTCGAAGCAA
>probe:Drosophila_2:1636398_at:170:589; Interrogation_Position=1486; Antisense; TGGAGTCACCCGTGCAGATCTGAGG
>probe:Drosophila_2:1636398_at:552:97; Interrogation_Position=1501; Antisense; AGATCTGAGGGCAGTTATCGCGAAA
>probe:Drosophila_2:1636398_at:74:297; Interrogation_Position=1531; Antisense; CGACTATATCTTATCTCGGCAGTAT
>probe:Drosophila_2:1636398_at:296:695; Interrogation_Position=1556; Antisense; TTATTTCTTTTACGGTTCGCCAGTG
>probe:Drosophila_2:1636398_at:358:541; Interrogation_Position=1569; Antisense; GGTTCGCCAGTGTACTTACCAAAAT
>probe:Drosophila_2:1636398_at:165:85; Interrogation_Position=1645; Antisense; AGTGTCTACTGGGTGATACGCGATA
>probe:Drosophila_2:1636398_at:210:3; Interrogation_Position=1671; Antisense; ATTGCGACTATAGCCTAGACAACCA
>probe:Drosophila_2:1636398_at:708:391; Interrogation_Position=1688; Antisense; GACAACCAAGTCCATGAAGGCATTG
>probe:Drosophila_2:1636398_at:222:75; Interrogation_Position=1755; Antisense; AGGACTTCTAGCTCAGTCCGTGAGT
>probe:Drosophila_2:1636398_at:693:135; Interrogation_Position=1813; Antisense; ACGCATACATGCTCCCAATTTCTAA

Paste this into a BLAST search page for me
ATGACCACTGATATTGCGGACACGGACACGGACGCGAACACGGTCAGCGAACGCTATCCGGTCTTCGATGTGGACTGCCGATCCTGGACAGTCGAAGCAATGGAGTCACCCGTGCAGATCTGAGGAGATCTGAGGGCAGTTATCGCGAAACGACTATATCTTATCTCGGCAGTATTTATTTCTTTTACGGTTCGCCAGTGGGTTCGCCAGTGTACTTACCAAAATAGTGTCTACTGGGTGATACGCGATAATTGCGACTATAGCCTAGACAACCAGACAACCAAGTCCATGAAGGCATTGAGGACTTCTAGCTCAGTCCGTGAGTACGCATACATGCTCCCAATTTCTAA

Full Affymetrix probeset data:

Annotations for 1636398_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720