Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636402_at:

>probe:Drosophila_2:1636402_at:324:401; Interrogation_Position=2168; Antisense; GACATCCGATTGTGCCAAGTACATG
>probe:Drosophila_2:1636402_at:57:51; Interrogation_Position=2202; Antisense; ATGCCGCTGTACGATCACCGATGGG
>probe:Drosophila_2:1636402_at:703:389; Interrogation_Position=2238; Antisense; GAAACTACCATGTGGCTGCCGCGAA
>probe:Drosophila_2:1636402_at:634:281; Interrogation_Position=2253; Antisense; CTGCCGCGAAAGAATCCCGTTTGGA
>probe:Drosophila_2:1636402_at:701:727; Interrogation_Position=2273; Antisense; TTGGACACCAGCTGAACCGATTCTA
>probe:Drosophila_2:1636402_at:429:69; Interrogation_Position=2326; Antisense; ATGGCCAGACTGTTCAATTCGAGTT
>probe:Drosophila_2:1636402_at:663:429; Interrogation_Position=2346; Antisense; GAGTTTGAACTAACGACCTCGGATC
>probe:Drosophila_2:1636402_at:297:545; Interrogation_Position=2366; Antisense; GGATCACACCAGCATTTTCATTTCT
>probe:Drosophila_2:1636402_at:220:443; Interrogation_Position=2400; Antisense; GATGTGATCATCTCCAATTGGTCGT
>probe:Drosophila_2:1636402_at:322:151; Interrogation_Position=2464; Antisense; ACATCTACTACTCCTTTGGTATCGA
>probe:Drosophila_2:1636402_at:475:483; Interrogation_Position=2482; Antisense; GTATCGATAATACTCCACTGCGCTT
>probe:Drosophila_2:1636402_at:727:623; Interrogation_Position=2500; Antisense; TGCGCTTCCACATCGAGCTTAAGAA
>probe:Drosophila_2:1636402_at:619:605; Interrogation_Position=2597; Antisense; TGATGAGTCCATCAGGCTTGCCAAT
>probe:Drosophila_2:1636402_at:506:495; Interrogation_Position=2640; Antisense; GTCAGTATTCAGTGGCCAGCTATGT

Paste this into a BLAST search page for me
GACATCCGATTGTGCCAAGTACATGATGCCGCTGTACGATCACCGATGGGGAAACTACCATGTGGCTGCCGCGAACTGCCGCGAAAGAATCCCGTTTGGATTGGACACCAGCTGAACCGATTCTAATGGCCAGACTGTTCAATTCGAGTTGAGTTTGAACTAACGACCTCGGATCGGATCACACCAGCATTTTCATTTCTGATGTGATCATCTCCAATTGGTCGTACATCTACTACTCCTTTGGTATCGAGTATCGATAATACTCCACTGCGCTTTGCGCTTCCACATCGAGCTTAAGAATGATGAGTCCATCAGGCTTGCCAATGTCAGTATTCAGTGGCCAGCTATGT

Full Affymetrix probeset data:

Annotations for 1636402_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime