FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636403_at:

>probe:Drosophila_2:1636403_at:696:71; Interrogation_Position=1172; Antisense; AGGAATCGCTGGTTTTTCCTGCCTA
>probe:Drosophila_2:1636403_at:657:419; Interrogation_Position=1235; Antisense; GAGCACATGGGCTGCAATGTCCTGG
>probe:Drosophila_2:1636403_at:226:393; Interrogation_Position=1271; Antisense; GAAAGCTTCACCAACGTTGAGACTG
>probe:Drosophila_2:1636403_at:245:407; Interrogation_Position=1291; Antisense; GACTGTACGGCTCGATCCTGAAAAT
>probe:Drosophila_2:1636403_at:585:309; Interrogation_Position=1323; Antisense; CCACGCATGGTTTCTCTAGCTTTAA
>probe:Drosophila_2:1636403_at:401:611; Interrogation_Position=1337; Antisense; TCTAGCTTTAAGTTCTTGCCCGGCA
>probe:Drosophila_2:1636403_at:24:625; Interrogation_Position=1353; Antisense; TGCCCGGCACCGATGACTCAATAAT
>probe:Drosophila_2:1636403_at:72:249; Interrogation_Position=1371; Antisense; CAATAATCGTGGCTCTTAAGTCGGA
>probe:Drosophila_2:1636403_at:35:259; Interrogation_Position=1426; Antisense; CACAGCCTTCGATATTGCGGGCAAG
>probe:Drosophila_2:1636403_at:470:93; Interrogation_Position=1503; Antisense; AGTTCATTTAGCTCGCCATTCCAAG
>probe:Drosophila_2:1636403_at:330:715; Interrogation_Position=1547; Antisense; TTCGATCCAGGTGCTTCAGTTTTAA
>probe:Drosophila_2:1636403_at:578:671; Interrogation_Position=1586; Antisense; TATTATTGTCCCATACGGTAAGCTT
>probe:Drosophila_2:1636403_at:665:99; Interrogation_Position=1638; Antisense; AGAGATGCTCATCTGCCTCATGAAC
>probe:Drosophila_2:1636403_at:366:503; Interrogation_Position=1674; Antisense; GTCCCGTCTTGTACCATAGCACAAA

Paste this into a BLAST search page for me
AGGAATCGCTGGTTTTTCCTGCCTAGAGCACATGGGCTGCAATGTCCTGGGAAAGCTTCACCAACGTTGAGACTGGACTGTACGGCTCGATCCTGAAAATCCACGCATGGTTTCTCTAGCTTTAATCTAGCTTTAAGTTCTTGCCCGGCATGCCCGGCACCGATGACTCAATAATCAATAATCGTGGCTCTTAAGTCGGACACAGCCTTCGATATTGCGGGCAAGAGTTCATTTAGCTCGCCATTCCAAGTTCGATCCAGGTGCTTCAGTTTTAATATTATTGTCCCATACGGTAAGCTTAGAGATGCTCATCTGCCTCATGAACGTCCCGTCTTGTACCATAGCACAAA

Full Affymetrix probeset data:

Annotations for 1636403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720