FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636404_at:

>probe:Drosophila_2:1636404_at:192:47; Interrogation_Position=251; Antisense; ATCCAAAGAGGAGAGCACCGCCCAA
>probe:Drosophila_2:1636404_at:705:213; Interrogation_Position=256; Antisense; AAGAGGAGAGCACCGCCCAAATGTA
>probe:Drosophila_2:1636404_at:304:113; Interrogation_Position=264; Antisense; AGCACCGCCCAAATGTAAGCCAATG
>probe:Drosophila_2:1636404_at:707:107; Interrogation_Position=431; Antisense; AGAAGCACTGTGACTTGAAGCCGCA
>probe:Drosophila_2:1636404_at:366:209; Interrogation_Position=433; Antisense; AAGCACTGTGACTTGAAGCCGCAGG
>probe:Drosophila_2:1636404_at:151:721; Interrogation_Position=445; Antisense; TTGAAGCCGCAGGAATTAATTGCAG
>probe:Drosophila_2:1636404_at:549:319; Interrogation_Position=450; Antisense; GCCGCAGGAATTAATTGCAGAGGCC
>probe:Drosophila_2:1636404_at:632:173; Interrogation_Position=478; Antisense; AAAGCGTGGGCCGAGCTCCCGGAGC
>probe:Drosophila_2:1636404_at:324:417; Interrogation_Position=490; Antisense; GAGCTCCCGGAGCATAGAAAGGATA
>probe:Drosophila_2:1636404_at:47:305; Interrogation_Position=496; Antisense; CCGGAGCATAGAAAGGATAGATACC
>probe:Drosophila_2:1636404_at:618:657; Interrogation_Position=612; Antisense; TAAGTCCAGGCATATATTTTCATTG
>probe:Drosophila_2:1636404_at:400:307; Interrogation_Position=617; Antisense; CCAGGCATATATTTTCATTGATTTG
>probe:Drosophila_2:1636404_at:306:5; Interrogation_Position=633; Antisense; ATTGATTTGATACCATTCGATGAAT
>probe:Drosophila_2:1636404_at:185:457; Interrogation_Position=641; Antisense; GATACCATTCGATGAATTTAGAAAT

Paste this into a BLAST search page for me
ATCCAAAGAGGAGAGCACCGCCCAAAAGAGGAGAGCACCGCCCAAATGTAAGCACCGCCCAAATGTAAGCCAATGAGAAGCACTGTGACTTGAAGCCGCAAAGCACTGTGACTTGAAGCCGCAGGTTGAAGCCGCAGGAATTAATTGCAGGCCGCAGGAATTAATTGCAGAGGCCAAAGCGTGGGCCGAGCTCCCGGAGCGAGCTCCCGGAGCATAGAAAGGATACCGGAGCATAGAAAGGATAGATACCTAAGTCCAGGCATATATTTTCATTGCCAGGCATATATTTTCATTGATTTGATTGATTTGATACCATTCGATGAATGATACCATTCGATGAATTTAGAAAT

Full Affymetrix probeset data:

Annotations for 1636404_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720