FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636406_at:

>probe:Drosophila_2:1636406_at:449:581; Interrogation_Position=2757; Antisense; TGGCAACCGGCCAGGGTACGACTTT
>probe:Drosophila_2:1636406_at:125:135; Interrogation_Position=2805; Antisense; ACGCCGTGGTCATGGGCTCATCCGG
>probe:Drosophila_2:1636406_at:107:647; Interrogation_Position=2822; Antisense; TCATCCGGCGAGGTGTACTTCGTGA
>probe:Drosophila_2:1636406_at:467:667; Interrogation_Position=2837; Antisense; TACTTCGTGACGCAGGCGTAGCCAG
>probe:Drosophila_2:1636406_at:389:391; Interrogation_Position=2889; Antisense; GAAACGGCGAGTGCCTGCTCGGCAT
>probe:Drosophila_2:1636406_at:497:283; Interrogation_Position=2903; Antisense; CTGCTCGGCATTTAGATGACCACTT
>probe:Drosophila_2:1636406_at:674:361; Interrogation_Position=3019; Antisense; GCAATCCTAGATTTCTGTCGTAGAA
>probe:Drosophila_2:1636406_at:673:89; Interrogation_Position=3051; Antisense; AGTAGGACCTAAGCGATTCACTCGA
>probe:Drosophila_2:1636406_at:96:463; Interrogation_Position=3065; Antisense; GATTCACTCGAATTTTGTAAGCAGA
>probe:Drosophila_2:1636406_at:409:679; Interrogation_Position=3104; Antisense; TAGGCAGATCGAGGCGGATCCTCAC
>probe:Drosophila_2:1636406_at:720:545; Interrogation_Position=3119; Antisense; GGATCCTCACATCCAAACGCTTGGG
>probe:Drosophila_2:1636406_at:33:31; Interrogation_Position=3146; Antisense; ATAAATCCTGCGTGGACTGTGCCAG
>probe:Drosophila_2:1636406_at:543:665; Interrogation_Position=3224; Antisense; TACAGACTGGCATTTTAGGCTAAAC
>probe:Drosophila_2:1636406_at:78:473; Interrogation_Position=3249; Antisense; GTATTTTGGCGTTGGGTTTTCATTG

Paste this into a BLAST search page for me
TGGCAACCGGCCAGGGTACGACTTTACGCCGTGGTCATGGGCTCATCCGGTCATCCGGCGAGGTGTACTTCGTGATACTTCGTGACGCAGGCGTAGCCAGGAAACGGCGAGTGCCTGCTCGGCATCTGCTCGGCATTTAGATGACCACTTGCAATCCTAGATTTCTGTCGTAGAAAGTAGGACCTAAGCGATTCACTCGAGATTCACTCGAATTTTGTAAGCAGATAGGCAGATCGAGGCGGATCCTCACGGATCCTCACATCCAAACGCTTGGGATAAATCCTGCGTGGACTGTGCCAGTACAGACTGGCATTTTAGGCTAAACGTATTTTGGCGTTGGGTTTTCATTG

Full Affymetrix probeset data:

Annotations for 1636406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720