FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636407_at:

>probe:Drosophila_2:1636407_at:574:209; Interrogation_Position=1978; Antisense; AAGCAACTTCTTAGTGCGCGAGAGT
>probe:Drosophila_2:1636407_at:108:65; Interrogation_Position=2033; Antisense; ATGGGCGCTACTCGACTGGATGCTT
>probe:Drosophila_2:1636407_at:52:447; Interrogation_Position=2051; Antisense; GATGCTTTGGTGGTCGCCAACGCCA
>probe:Drosophila_2:1636407_at:522:285; Interrogation_Position=2081; Antisense; CTGTGCTGGTGTCTAGCCTAGGTCA
>probe:Drosophila_2:1636407_at:198:385; Interrogation_Position=2145; Antisense; GAACTCGTCGCAGGCCTTGAAGCAC
>probe:Drosophila_2:1636407_at:677:611; Interrogation_Position=2211; Antisense; TGAAAGTTTTGACTTCGCCCGTACT
>probe:Drosophila_2:1636407_at:40:317; Interrogation_Position=2227; Antisense; GCCCGTACTCGGAGACGATTCATGA
>probe:Drosophila_2:1636407_at:425:295; Interrogation_Position=2262; Antisense; CGACGAAATATCCTTGCGCTCACTT
>probe:Drosophila_2:1636407_at:345:721; Interrogation_Position=2275; Antisense; TTGCGCTCACTTCCCAGGAGAGGAG
>probe:Drosophila_2:1636407_at:594:425; Interrogation_Position=2292; Antisense; GAGAGGAGCAACGTCTGCGGCACAT
>probe:Drosophila_2:1636407_at:313:623; Interrogation_Position=2307; Antisense; TGCGGCACATCGACAGTTGCATCGG
>probe:Drosophila_2:1636407_at:503:103; Interrogation_Position=2337; Antisense; AGAGCCAGATGACAGCGTACACACT
>probe:Drosophila_2:1636407_at:204:533; Interrogation_Position=2392; Antisense; GGTGTGGACCTTAACCAGTGATTAA
>probe:Drosophila_2:1636407_at:36:31; Interrogation_Position=2524; Antisense; ATACATATCTCGTTGCACTTCTAAT

Paste this into a BLAST search page for me
AAGCAACTTCTTAGTGCGCGAGAGTATGGGCGCTACTCGACTGGATGCTTGATGCTTTGGTGGTCGCCAACGCCACTGTGCTGGTGTCTAGCCTAGGTCAGAACTCGTCGCAGGCCTTGAAGCACTGAAAGTTTTGACTTCGCCCGTACTGCCCGTACTCGGAGACGATTCATGACGACGAAATATCCTTGCGCTCACTTTTGCGCTCACTTCCCAGGAGAGGAGGAGAGGAGCAACGTCTGCGGCACATTGCGGCACATCGACAGTTGCATCGGAGAGCCAGATGACAGCGTACACACTGGTGTGGACCTTAACCAGTGATTAAATACATATCTCGTTGCACTTCTAAT

Full Affymetrix probeset data:

Annotations for 1636407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720