FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636409_at:

>probe:Drosophila_2:1636409_at:616:657; Interrogation_Position=1686; Antisense; TAAGGGCAAGGATCTGCTCTTCTCG
>probe:Drosophila_2:1636409_at:713:337; Interrogation_Position=1701; Antisense; GCTCTTCTCGGTCAACAATGATCTG
>probe:Drosophila_2:1636409_at:236:647; Interrogation_Position=1731; Antisense; TCACGAGGTCGAGGATCAACTGTTC
>probe:Drosophila_2:1636409_at:485:143; Interrogation_Position=1749; Antisense; ACTGTTCGTCACTCGTTGGATGCAA
>probe:Drosophila_2:1636409_at:254:53; Interrogation_Position=1768; Antisense; ATGCAACAAAATCTGGCCTTCGTGG
>probe:Drosophila_2:1636409_at:725:39; Interrogation_Position=1868; Antisense; ATCGGGTCTTTCAGTGCGGAGTTTC
>probe:Drosophila_2:1636409_at:345:629; Interrogation_Position=1899; Antisense; TCCAGTTACCTCATGGCTGTACTAT
>probe:Drosophila_2:1636409_at:98:27; Interrogation_Position=1934; Antisense; ATACCGAGCGCTATATGGGACTTCC
>probe:Drosophila_2:1636409_at:670:593; Interrogation_Position=1949; Antisense; TGGGACTTCCCACTGACGATGACAA
>probe:Drosophila_2:1636409_at:45:103; Interrogation_Position=1991; Antisense; AGAGCAGCGTGTTCGGCAACTTGGA
>probe:Drosophila_2:1636409_at:441:203; Interrogation_Position=2025; Antisense; AAGCCACGACTTTCTGTTGATTCAC
>probe:Drosophila_2:1636409_at:20:141; Interrogation_Position=2048; Antisense; ACGGTTCCGGCGATGACAATGTCCA
>probe:Drosophila_2:1636409_at:282:601; Interrogation_Position=2183; Antisense; TGTACCATACCATTGATGCCTTCTG
>probe:Drosophila_2:1636409_at:574:627; Interrogation_Position=2215; Antisense; TGCCTCAACCTGGATGTCTACGAAG

Paste this into a BLAST search page for me
TAAGGGCAAGGATCTGCTCTTCTCGGCTCTTCTCGGTCAACAATGATCTGTCACGAGGTCGAGGATCAACTGTTCACTGTTCGTCACTCGTTGGATGCAAATGCAACAAAATCTGGCCTTCGTGGATCGGGTCTTTCAGTGCGGAGTTTCTCCAGTTACCTCATGGCTGTACTATATACCGAGCGCTATATGGGACTTCCTGGGACTTCCCACTGACGATGACAAAGAGCAGCGTGTTCGGCAACTTGGAAAGCCACGACTTTCTGTTGATTCACACGGTTCCGGCGATGACAATGTCCATGTACCATACCATTGATGCCTTCTGTGCCTCAACCTGGATGTCTACGAAG

Full Affymetrix probeset data:

Annotations for 1636409_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720